TkA04G178600 | RubberDandelionOmics

Gene overview

TkA04G178600

Reference: TK1151 Chr: Chr04 Coordinates: 46226358-46227515 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1158 bp · TkA04G178600|TK1151|cDNA

ATGGATGAAGAAGATAACACCCGACCGGAACACATTCCACATGAACTAGTGTCCGAAATACTCACACGCCTCGACGTCAAATCATTGACCCGATTCCGCTCCGTTTCTACCCGATGGAACTCCACCATTGTCCATCCATCTTTCTCCAAATCCCACCTCTGTCACTCCCCCACCGGCGCCGGAGCTCCTGTTACACTCGTCCTCTCCTTCATCAACCGCTTCAATTCCGAGCGCACCGTCTTCTCCGTCAAGATTCTGCC...

CDS

Download CDS FASTA

1158 bp · TkA04G178600|TK1151|CDS

ATGGATGAAGAAGATAACACCCGACCGGAACACATTCCACATGAACTAGTGTCCGAAATACTCACACGCCTCGACGTCAAATCATTGACCCGATTCCGCTCCGTTTCTACCCGATGGAACTCCACCATTGTCCATCCATCTTTCTCCAAATCCCACCTCTGTCACTCCCCCACCGGCGCCGGAGCTCCTGTTACACTCGTCCTCTCCTTCATCAACCGCTTCAATTCCGAGCGCACCGTCTTCTCCGTCAAGATTCTGCC...

Protein

Download Protein FASTA

385 aa · TkA04G178600|TK1151|PROTEIN

MDEEDNTRPEHIPHELVSEILTRLDVKSLTRFRSVSTRWNSTIVHPSFSKSHLCHSPTGAGAPVTLVLSFINRFNSERTVFSVKILPNQTTSLPNPTHVLTIPGFAHPFVSQSLNGLICFNLGAMCVCNPSTRKFLKLPWSKTEIPPPSPASTHHRRNAFGFDPVSNAHKVLDTWITCHENEMVMEHKIFTVGSGCNKWKRIADGPPYFPFNESVCINGQIYFRAFTSVTDSEETVMVAFDVNREEFRFIQMRDDAISNS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G178600`
TK1151 ID	TkA04G178600
OH-1004 ID	LXL04_035031
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G178600

Location Chr04:46226358-46227515 (+)

Description Similar to At1g30790: F-box protein At1g30790

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30790`	F-box protein At1g30790.	No verified direct reference in this release
`At1g47790`	Putative F-box protein At1g47790.	No verified direct reference in this release
`At1g50870`	Putative F-box protein At1g50870.	No verified direct reference in this release
`At1g47800`	Putative F-box protein At1g47800.	No verified direct reference in this release
`At1g20657`	Putative F-box protein At1g20657.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035031 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010118 stomatal movement Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G30790

ath:AT1G47790

ath:AT2G31470

ath:AT3G57590

ath:AT5G62510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.616

Rank 1 · TkA04G178600 · TK1151

Nucleus0.419

Rank 2 · TkA04G178600 · TK1151

Cell membrane0.124

Rank 3 · TkA04G178600 · TK1151

Endoplasmic reticulum0.074

Rank 4 · TkA04G178600 · TK1151

Lysosome / Vacuole0.026

Rank 5 · TkA04G178600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box11-48 aa

PF12937F-box-like11-48 aa

PF08268FBA_375-367 aa

PF24750b-prop_At3g26010-like110-295 aa

PF07734FBA_1115-296 aa

PF00646F-box196-207 aa

PF12937F-box-like196-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G178600	`PF00646`	F-box	11	48	7.5e-10	39.0
TkA04G178600	`PF12937`	F-box-like	11	48	1.6e-07	31.7
TkA04G178600	`PF08268`	FBA_3	75	367	2e-63	215.0
TkA04G178600	`PF24750`	b-prop_At3g26010-like	110	295	0.00017	21.5
TkA04G178600	`PF07734`	FBA_1	115	296	1e-12	48.4
TkA04G178600	`PF00646`	F-box	196	207	7.5e-10	39.0
TkA04G178600	`PF12937`	F-box-like	196	205	1.6e-07	31.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SY20`	Arabidopsis thaliana	sp\|Q9SY20\|FB20_ARATH F-box protein At1g30790	31.000%	Swiss-Prot	Medium
`Q9FZF8`	Arabidopsis thaliana	sp\|Q9FZF8\|FB44_ARATH Putative F-box protein At1g47790	29.200%	Swiss-Prot	Low
`Q9C6J3`	Arabidopsis thaliana	sp\|Q9C6J3\|FB52_ARATH Putative F-box protein At1g50870	29.600%	Swiss-Prot	Low
`P0C2G5`	Arabidopsis thaliana	sp\|P0C2G5\|FB45_ARATH Putative F-box protein At1g47800	26.500%	Swiss-Prot	Low
`Q9LM89`	Arabidopsis thaliana	sp\|Q9LM89\|FB12_ARATH Putative F-box protein At1g20657	27.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card