TkA04G173400 | RubberDandelionOmics

Gene overview

TkA04G173400

Reference: TK1151 Chr: Chr04 Coordinates: 44850311-44851945 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1333 bp · TkA04G173400|TK1151|cDNA

TAAAATTTAAACAGTAACTTAAATTTCAACACAAAAATAATCGAATTGACATACGCATACTATAATTAAACAGATGAAATTAAAAAGGGGGGTGAATAGAAATCGAAAAGCGGAAGAAATTGTCTCCGAAGAAACGTTTCCAATCAGGATACATAGAGCTTTATCCGCCCGTGCCACTGATATCACAATATGACGACGGCGGAGAACCGTTCTGCAACCACAAATTCCAGATGGTCTTTGGCTGGAATGACTGCTCTCGT...

CDS

Download CDS FASTA

804 bp · TkA04G173400|TK1151|CDS

ATGACGACGGCGGAGAACCGTTCTGCAACCACAAATTCCAGATGGTCTTTGGCTGGAATGACTGCTCTCGTCACCGGTGGCACACGTGGTATCGGCTACGCTGTGGTGGAGGAATTGGCGGGGTTAGGGGCGGCGGTTCACACCTGCTCTCGCAACGAGGCGGAACTTAACCAACGCTTACACGAATGGTCTCTCAAGGGCTTCACCGTCACCGGATCCATCTGCGACGCAACTTCTCGACCTCATCGCGAACAACTTCT...

Protein

Download Protein FASTA

267 aa · TkA04G173400|TK1151|PROTEIN

MTTAENRSATTNSRWSLAGMTALVTGGTRGIGYAVVEELAGLGAAVHTCSRNEAELNQRLHEWSLKGFTVTGSICDATSRPHREQLLEKVSSVFNGKLNILINNVGTNIRKATTEYTAEEYSLIMATNLESSYHMCQLAHPLLKASGSGSIVFISSVAGSVHLSSGSIYGATKGAINQLAKNLSCEWAKDKIRTNSVAPWYTKTPLVQHLLENEEYLERVVSRTPMKRVAEPNEVSSLVAFLCLPAASYITGQTIAVDGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G173400`
TK1151 ID	TkA04G173400
OH-1004 ID	LXL04_035058
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	79.500
Protein coverage (%)	TK1151 97.004 / OH-1004 94.526 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G173400

Location Chr04:44850311-44851945 (+)

Description Similar to SDR: Tropinone reductase homolog At2g29360

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06060`	Tropinone reductase homolog At5g06060.	No verified direct reference in this release
`At2g29350`	Unspecific reductase providing both diastereomeric alcohols from the prochiral ketones.	No verified direct reference in this release
`At2g29360`	Oxidoreductase active on cyclic ketones, but not on tropinone or nortropinone.	No verified direct reference in this release
`At2g29290`	Tropinone reductase homolog At2g29290.	No verified direct reference in this release
`At2g29170`	Tropinone reductase homolog At2g29170.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035058 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002213 defense response to insect Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004022 alcohol dehydrogenase (NAD+) activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0050356 tropine dehydrogenase activity Molecular Function

GO:0050358 tropinone reductase activity Molecular Function

KEGG gene cross-reference

ath:AT2G29290

ath:AT2G29350

ath:AT2G29360

ath:AT5G06060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.435

Rank 1 · TkA04G173400 · TK1151

Mitochondrion0.304

Rank 2 · TkA04G173400 · TK1151

Peroxisome0.227

Rank 3 · TkA04G173400 · TK1151

Nucleus0.146

Rank 4 · TkA04G173400 · TK1151

Plastid0.039

Rank 5 · TkA04G173400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short21-214 aa

PF08659KR21-182 aa

PF01370Epimerase22-174 aa

PF07993NAD_binding_425-158 aa

PF13561adh_short_C229-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G173400	`PF00106`	adh_short	21	214	8.2e-48	163.2
TkA04G173400	`PF08659`	KR	21	182	8.1e-10	39.6
TkA04G173400	`PF01370`	Epimerase	22	174	0.00016	21.9
TkA04G173400	`PF07993`	NAD_binding_4	25	158	0.22	11.4
TkA04G173400	`PF13561`	adh_short_C2	29	262	5.5e-56	190.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHT0`	Arabidopsis thaliana	sp\|Q9LHT0\|TRNHF_ARATH Tropinone reductase homolog At5g06060	72.400%	Swiss-Prot	High
`Q9ZW18`	Arabidopsis thaliana	sp\|Q9ZW18\|SAG13_ARATH Senescence-associated protein 13	69.500%	Swiss-Prot	High
`Q9ZW19`	Arabidopsis thaliana	sp\|Q9ZW19\|TRNHC_ARATH Tropinone reductase homolog At2g29360	68.100%	Swiss-Prot	High
`Q9ZW13`	Arabidopsis thaliana	sp\|Q9ZW13\|TRNH6_ARATH Tropinone reductase homolog At2g29290	68.500%	Swiss-Prot	High
`Q9ZW04`	Arabidopsis thaliana	sp\|Q9ZW04\|TRNH4_ARATH Tropinone reductase homolog At2g29170	67.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card