TkA04G165060 | RubberDandelionOmics

Gene overview

TkA04G165060

Reference: TK1151 Chr: Chr04 Coordinates: 42644122-42645495 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

510 bp · TkA04G165060|TK1151|cDNA

ATGCAAACTCATCTTGATAAAGAATCAAAGAAGAATTTTTTTGCTGGTGACGAAGCAGCGGGGAAGCAGTTTTGTACCGAGAAGACAAGGGAAGCATATGAAGCATACTCTCGAGCCTTGGTTGAGAAGTATGGGGATGATTTACGTGATCATGCAATTGATCATGTTGAACTTTGGAAGATAAGTAAATGTTCGAAGACCAGTTACATATATGGGATTGGATCCTCAGATTTGGAGTATGTGGTCACGGGGAAATCATC...

CDS

Download CDS FASTA

510 bp · TkA04G165060|TK1151|CDS

ATGCAAACTCATCTTGATAAAGAATCAAAGAAGAATTTTTTTGCTGGTGACGAAGCAGCGGGGAAGCAGTTTTGTACCGAGAAGACAAGGGAAGCATATGAAGCATACTCTCGAGCCTTGGTTGAGAAGTATGGGGATGATTTACGTGATCATGCAATTGATCATGTTGAACTTTGGAAGATAAGTAAATGTTCGAAGACCAGTTACATATATGGGATTGGATCCTCAGATTTGGAGTATGTGGTCACGGGGAAATCATC...

Protein

Download Protein FASTA

169 aa · TkA04G165060|TK1151|PROTEIN

MQTHLDKESKKNFFAGDEAAGKQFCTEKTREAYEAYSRALVEKYGDDLRDHAIDHVELWKISKCSKTSYIYGIGSSDLEYVVTGKSSAASCSSSSCESQHEVNELRIKLDTVEKDILLIRARTFGSFTALLLMQEKLENTERNTLEMQKKKKKKTRCNGTTNQPTNETM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G165060`
TK1151 ID	TkA04G165060
OH-1004 ID	LXL04_035122
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 71.598 / OH-1004 19.804 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G165060`
Location	Chr04:42644122-42645495 (-)
Description	Similar to CIPK2: CBL-interacting protein kinase 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035122` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007165 signal transduction Biological Process GO:0009737 response to abscisic acid Biological Process GO:0005634 nucleus Cellular Component GO:0004674 protein serine/threonine kinase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0106310 protein serine kinase activity Molecular Function
KEGG gene cross-reference	ath:AT5G45820 dosa:Os01g0206700 dosa:Os03g0339900 dosa:Os05g0332300 dosa:Os07g0678600 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.909

Rank 1 · TkA04G165060 · TK1151

Cytoplasm0.213

Rank 2 · TkA04G165060 · TK1151

Mitochondrion0.022

Rank 3 · TkA04G165060 · TK1151

Cell membrane0.016

Rank 4 · TkA04G165060 · TK1151

Extracellular0.013

Rank 5 · TkA04G165060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06015Chordopox_A30L5-17 aa

PF14795Leucyl-specific36-60 aa

PF14795Leucyl-specific103-113 aa

PF06015Chordopox_A30L129-162 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G165060	`PF06015`	Chordopox_A30L	5	17	0.0098	16.4
TkA04G165060	`PF14795`	Leucyl-specific	36	60	0.32	11.9
TkA04G165060	`PF14795`	Leucyl-specific	103	113	0.32	11.9
TkA04G165060	`PF06015`	Chordopox_A30L	129	162	0.0098	16.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card