TkA04G150130 | RubberDandelionOmics

Gene overview

TkA04G150130

Reference: TK1151 Chr: Chr04 Coordinates: 38865043-38867849 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1877 bp · TkA04G150130|TK1151|cDNA

AATACCACAGCCCCATATTCCATTCTGCAATACAAACACAACCGATCCTATTTACACACACACACACACACACACATCTACCCAGAAATTAAAAAAAAAATGGAGAATCTTGAAGCAATTGCATTTGCAATGGCAGCATTTTTCTCATTTCTCTTATGGAGGGTGCTATATTCTTGCTGGGTTTTGCCCATAAGGGCTTACAGAAAGCTCGCCATTAACGGGTTTTCTGGTCCACCTCCAAGATTTCCTCTGGGAAACAC...

CDS

Download CDS FASTA

1656 bp · TkA04G150130|TK1151|CDS

AATACCACAGCCCCATATTCCATTCTGCAATACAAACACAACCGATCCTATTTACACACACACACACACACACACATCTACCCAGAAATTAAAAAAAAAATGGAGAATCTTGAAGCAATTGCATTTGCAATGGCAGCATTTTTCTCATTTCTCTTATGGAGGGTGCTATATTCTTGCTGGGTTTTGCCCATAAGGGCTTACAGAAAGCTCGCCATTAACGGGTTTTCTGGTCCACCTCCAAGATTTCCTCTGGGAAACAC...

Protein

Download Protein FASTA

551 aa · TkA04G150130|TK1151|PROTEIN

NTTAPYSILQYKHNRSYLHTHTHTHIYPEIKKKMENLEAIAFAMAAFFSFLLWRVLYSCWVLPIRAYRKLAINGFSGPPPRFPLGNTTEMKKTKRRELSSSSSSAVSNDIHSSVFPYFAQWQKSHGKVFMYWLGTEPFVYIADPEFLKKISSGVMGKSWGKPTVFKNDRKPMFGDGLLMVEGDDWVRHRHVIIPAFSPNNLKAMTSMMVETTKTMLDSWTALINSGNQEIEVEGEIISTAGEIIAKTSFGMNFESGRAVF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G150130`
TK1151 ID	TkA04G150130
OH-1004 ID	LXL04_024518
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	36.500
Protein coverage (%)	TK1151 91.107 / OH-1004 96.532 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G150130

Location Chr04:38865043-38867849 (+)

Description Similar to CYP735A1: Cytokinin hydroxylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g38450`	Cytokinin hydroxylase that catalyzes the biosynthesis of trans-zeatin via the isopentenyladenine riboside 5'-monophosphate (iPRMP)-dependent pathway.	Arabidopsis CYP735A1 and CYP735A2 encode cytokinin hydroxylases that catalyze the biosynthesis of trans-Zeatin.2004 · DOI: 10.1074/jbc.m406337200
`At1g67110`	Cytokinin hydroxylase that catalyzes the biosynthesis of trans-zeatin via the isopentenyladenine riboside 5'-monophosphate (iPRMP)-dependent pathway.	Arabidopsis CYP735A1 and CYP735A2 encode cytokinin hydroxylases that catalyze the biosynthesis of trans-Zeatin.2004 · DOI: 10.1074/jbc.m406337200
`At5g24900`	Involved in the inactivation of early gibberellin (GA) intermediates.	Two Arabidopsis cytochrome P450 monooxygenases, CYP714A1 and CYP714A2, function redundantly in plant development through gibberellin deactivation.2011 · DOI: 10.1111/j.1365-313x.2011.04596.x
`At5g24910`	Involved in the inactivation of early gibberellin (GA) intermediates.	Two Arabidopsis cytochrome P450 monooxygenases, CYP714A1 and CYP714A2, function redundantly in plant development through gibberellin deactivation.2011 · DOI: 10.1111/j.1365-313x.2011.04596.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0119311`	Cytochrome P450 714C3.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024518 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009753 response to jasmonic acid Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0033466 trans-zeatin biosynthetic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0004497 monooxygenase activity Molecular Function

KEGG gene cross-reference

ath:AT1G67110

ath:AT2G46950

ath:AT2G46960

ath:AT5G38450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.872

Rank 1 · TkA04G150130 · TK1151

Cytoplasm0.045

Rank 2 · TkA04G150130 · TK1151

Cell membrane0.043

Rank 3 · TkA04G150130 · TK1151

Golgi apparatus0.042

Rank 4 · TkA04G150130 · TK1151

Nucleus0.038

Rank 5 · TkA04G150130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p450115-530 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G150130	`PF00067`	p450	115	530	2.8e-79	267.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FF18`	Arabidopsis thaliana	sp\|Q9FF18\|C7351_ARATH Cytokinin hydroxylase	36.700%	Swiss-Prot	Medium
`Q9ZW95`	Arabidopsis thaliana	sp\|Q9ZW95\|C7352_ARATH Cytokinin hydroxylase	36.900%	Swiss-Prot	Medium
`Q6NKZ8`	Arabidopsis thaliana	sp\|Q6NKZ8\|C14A2_ARATH Cytochrome P450 714A2	33.300%	Swiss-Prot	Medium
`Q93Z79`	Arabidopsis thaliana	sp\|Q93Z79\|C14A1_ARATH Cytochrome P450 714A1	32.500%	Swiss-Prot	Medium
`B9G934`	Oryza sativa subsp. japonica	sp\|B9G934\|C14C3_ORYSJ Cytochrome P450 714C3	33.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card