TkA04G148520 | RubberDandelionOmics

Gene overview

TkA04G148520

Reference: TK1151 Chr: Chr04 Coordinates: 38485820-38490575 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

871 bp · TkA04G148520|TK1151|cDNA

TTTGATCTGGACTTTGATGACATGTATTTAGGTAAAACAAATTACAACTTTAAAGGTCAGCATCAGCAAGAAGGGTGTAAAGGCCAAGTTATTGACATCATTGATGAGGATGATGACATGGCGGGTGTGGACTTCTCCTTATCTTTTCCAATAGAAACAAGAAGTCTCCCAGACAATCATGGAACTAGAAAAAAACTGTCTTATGATTGGTGCAGTTTTCCTACAGCTGCTGAGATTACACTAGATTCACAAACAAAAGA...

CDS

Download CDS FASTA

3435 bp · TkA04G148520|TK1151|CDS

ATGAGAACTCGCTTTCTTACCGACTTCTTCAACTCCTCAACCGCATCTCAATCCTTACAAAACCTAGATTTCCTCCGATTTCCACCACCTGAGCTCCCTTCACCAATTATTTTCAACTTTGACAACCTCTCGTGTTTCGATCAAGTAGCCTCTCTTAACATCTCTGATGACGTCGAGCGGTTTTCTGTCAATGAATCTCTCAGTAAGTTATTCTCCGACGTTCTTCCTCAATACATCAATGTCGAGATCGATCAGCAAAT...

Protein

Download Protein FASTA

1144 aa · TkA04G148520|TK1151|PROTEIN

MRTRFLTDFFNSSTASQSLQNLDFLRFPPPELPSPIIFNFDNLSCFDQVASLNISDDVERFSVNESLSKLFSDVLPQYINVEIDQQIARAVNDREKIDGHLDDASNTISTLLEFETPELQSSLKDFCVLHEEKMHLLFEFEDAEVNMDLLDFSHEVHKLVDIQKSIFHVEDYHPEFQEDHRSDIIDNGSLIQGQISSNFRTFPLLEIDETSMGIDSYIPEDKHIIFESIEPQQWIQKDELSFDDNEHFLSKKFNILEHLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G148520`
TK1151 ID	TkA04G148520
OH-1004 ID	LXL04_035267
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G148520

Location Chr04:38485820-38490575 (-)

Description Similar to SHOC1: Protein SHORTAGE IN CHIASMATA 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g52290`	Essential for the formation of class I meiotic crossovers.	SHOC1, an XPF endonuclease-related protein, is essential for the formation of class I meiotic crossovers.2008 · DOI: 10.1016/j.cub.2008.08.041 SHOC1 and PTD form an XPF-ERCC1-like complex that is required for formation of class I crossovers.2011 · DOI: 10.1242/jcs.088229

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0642600`	Essential for normal crossover (CO) formation during meiosis.	OsSHOC1 and OsPTD1 are essential for crossover formation during rice meiosis.2019 · DOI: 10.1111/tpj.14214 A Multiprotein Complex Regulates Interference-Sensitive Crossover Formation in Rice.2019 · DOI: 10.1104/pp.19.00082

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035267 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000712 resolution of meiotic recombination intermediates Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT5G52290

dosa:Os02g0642600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.939

Rank 1 · TkA04G148520 · TK1151

Cytoplasm0.164

Rank 2 · TkA04G148520 · TK1151

Cell membrane0.027

Rank 3 · TkA04G148520 · TK1151

Endoplasmic reticulum0.014

Rank 4 · TkA04G148520 · TK1151

Mitochondrion0.012

Rank 5 · TkA04G148520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30140ZIP2_M613-681 aa

PF28664SHOC1_PDDEXK_dom614-771 aa

PF28629SHOC1_2HhH777-838 aa

PF29917SHOC1_HhH_tandem780-815 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G148520	`PF30140`	ZIP2_M	613	681	0.03	15.0
TkA04G148520	`PF28664`	SHOC1_PDDEXK_dom	614	771	2.3e-65	219.9
TkA04G148520	`PF28629`	SHOC1_2HhH	777	838	1.7e-28	99.2
TkA04G148520	`PF29917`	SHOC1_HhH_tandem	780	815	0.00052	20.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KG50`	Arabidopsis thaliana	sp\|F4KG50\|SHOC1_ARATH Protein SHORTAGE IN CHIASMATA 1	38.300%	Swiss-Prot	Low
`B9F1C0`	Oryza sativa subsp. japonica	sp\|B9F1C0\|SHOC1_ORYSJ Protein SHORTAGE IN CHIASMATA 1 homolog	47.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card