TkA04G144010 | RubberDandelionOmics

Gene overview

TkA04G144010

Reference: TK1151 Chr: Chr04 Coordinates: 37273761-37279427 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1899 bp · TkA04G144010|TK1151|cDNA

ATGGCGATGGCCACCGGACTAGGAACCTCCTTTTGTTCTCTTCCCTCACTCCAAAGACTCACCACCGCTACCACCAATGCCGCATCTTTCTCTTTTTTCAAGCTATCTTCTCCGTCGTCCCCCCTGTTCGTCTCCACTAGGCTACCTCCAAGTAATCGACAACACTATTCCGCAACAAAAGCGTCTTCTTCTACAACCTTCACCGAGTCTCAAGATCTGAAGGTTAATACAATTACCACGAAGCCGATAGAAGGTCAGAA...

CDS

Download CDS FASTA

1899 bp · TkA04G144010|TK1151|CDS

ATGGCGATGGCCACCGGACTAGGAACCTCCTTTTGTTCTCTTCCCTCACTCCAAAGACTCACCACCGCTACCACCAATGCCGCATCTTTCTCTTTTTTCAAGCTATCTTCTCCGTCGTCCCCCCTGTTCGTCTCCACTAGGCTACCTCCAAGTAATCGACAACACTATTCCGCAACAAAAGCGTCTTCTTCTACAACCTTCACCGAGTCTCAAGATCTGAAGGTTAATACAATTACCACGAAGCCGATAGAAGGTCAGAA...

Protein

Download Protein FASTA

632 aa · TkA04G144010|TK1151|PROTEIN

MAMATGLGTSFCSLPSLQRLTTATTNAASFSFFKLSSPSSPLFVSTRLPPSNRQHYSATKASSSTTFTESQDLKVNTITTKPIEGQKTGTSGLRKKVKVFMQENYLANWIQALFNSLPPEDYKNALLVLGGDGRYFNKEAAQLIIKIAAGNGVGKILVGKDGILSTPAANGGFIMSASHNPGGPEYDWGIKFNYSSGQPAPESITDMIYGNTLSISEIKLADIPDVDLSSVGVTKFGNFSVEVVDPVSDYLELMENVFDF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G144010`
TK1151 ID	TkA04G144010
OH-1004 ID	LXL04_035310
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G144010

Location Chr04:37273761-37279427 (-)

Description Similar to PGMP: Phosphoglucomutase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51820`	Catalyzes the reversible isomerization of alpha-D-glucose 1-phosphate to alpha-D-glucose 6-phosphate.	The plastidic phosphoglucomutase from Arabidopsis. A reversible enzyme reaction with an important role in metabolic control.2000 · DOI: 10.1104/pp.122.4.1193

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035310 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0005986 sucrose biosynthetic process Biological Process

GO:0006006 glucose metabolic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009590 detection of gravity Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0010319 stromule Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT5G51820

bna:106423685

sot:102585015

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.497

Rank 1 · TkA04G144010 · TK1151

Plastid0.255

Rank 2 · TkA04G144010 · TK1151

Nucleus0.147

Rank 3 · TkA04G144010 · TK1151

Peroxisome0.103

Rank 4 · TkA04G144010 · TK1151

Endoplasmic reticulum0.084

Rank 5 · TkA04G144010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02878PGM_PMM_I86-216 aa

PF00408PGM_PMM_IV124-136 aa

PF02879PGM_PMM_II140-158 aa

PF17936Big_6140-162 aa

PF17936Big_6207-245 aa

PF02879PGM_PMM_II249-353 aa

PF02880PGM_PMM_III361-483 aa

PF24947PGM1_C_vert_fung485-617 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G144010	`PF02878`	PGM_PMM_I	86	216	1.2e-25	90.6
TkA04G144010	`PF00408`	PGM_PMM_IV	124	136	0.0014	19.3
TkA04G144010	`PF02879`	PGM_PMM_II	140	158	6.5e-11	43.3
TkA04G144010	`PF17936`	Big_6	140	162	0.32	12.0
TkA04G144010	`PF17936`	Big_6	207	245	0.32	12.0
TkA04G144010	`PF02879`	PGM_PMM_II	249	353	6.5e-11	43.3
TkA04G144010	`PF02880`	PGM_PMM_III	361	483	8e-23	81.5
TkA04G144010	`PF24947`	PGM1_C_vert_fung	485	617	1.9e-50	171.5
TkA04G144010	`PF00408`	PGM_PMM_IV	542	593	0.0014	19.3
TkA04G144010	`PF17936`	Big_6	561	575	0.32	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SCY0`	Arabidopsis thaliana	sp\|Q9SCY0\|PGMP_ARATH Phosphoglucomutase, chloroplastic	84.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card