Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1509 bp · TkA04G132350|TK1151|cDNA
CACATGCATATGCAGTGTAGAACTCCATGTATATAGGCGACCACTTAATGTCGTTTATGAAAGTTGGACTTTAGCCGATGCGATTAGGGGCACTAAATCAAATCAAGAATGGCGAAATCATGGCCAAAATCCAAAACCCTAGATTCCATTCTCATCCACCATCATCATCCCCTCCTAGATGCTGACTATGAAACGTCTCCTGCTCTTCCTCGTCACCTTCCTCCACATATTCTACGATAATTGGGTCCCAAACCCCTCCT...
1128 bp · TkA04G132350|TK1151|CDS
ATGCTGACTATGAAACGTCTCCTGCTCTTCCTCGTCACCTTCCTCCACATATTCTACGATAATTGGGTCCCAAACCCCTCCTGCAACGTGATTCCCAGTGGCAACAATCAGGAAATTGATCATGTAGACTTTGGAAAACTGGAAGACGATCTTAAGGTTATCATGGTCGCTGATTTGCTCTTGACGGGACATGACTCGGCACCTGGATCTTTGGATCTACACTTCAAGGACTTCTTCTTTTCTCGATTCTTCAGAAAATC...
Protein
Download Protein FASTA375 aa · TkA04G132350|TK1151|PROTEIN
MLTMKRLLLFLVTFLHIFYDNWVPNPSCNVIPSGNNQEIDHVDFGKLEDDLKVIMVADLLLTGHDSAPGSLDLHFKDFFFSRFFRKSFEFLKPDMLIVLGDVSAQGSKLTTSKWSFLLHEFHSLLGPFLDLPYHVVPGDRDIGECNGLKEKSVTKMTRNFPGLDSAGCGAFEIGNVNFVSLNSIPLLCGNSDLRFSVEKALEREHMETESESAIDESSGIKIPKYDINWRENTMSSGSGPVLLLHFPLHQTENNWNSQPL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G132350 |
|---|---|
| TK1151 ID | TkA04G132350 |
| OH-1004 ID | LXL04_035415 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G132350 |
|---|---|
| Location | Chr04:34448479-34452755 (+) |
| Description | Similar to Mppe1: Metallophosphoesterase 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006506 GPI anchor biosynthetic process Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0033116 endoplasmic reticulum-Golgi intermediate compartment membrane Cellular Component GO:0070971 endoplasmic reticulum exit site Cellular Component GO:0030145 manganese ion binding Molecular Function GO:0034235 GPI anchor binding Molecular Function GO:0062050 GPI-mannose ethanolamine phosphate phosphodiesterase activity Molecular Function |
| KEGG gene cross-reference | cge:100689457 hsa:65258 mmu:225651 rno:361344 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00149Metallophos35-64 aaPF00149Metallophos72-297 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G132350 | PF00149 | Metallophos | 35 | 64 | 0.00013 | 23.2 |
| TkA04G132350 | PF00149 | Metallophos | 72 | 297 | 0.00013 | 23.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.