TkA04G126480 | RubberDandelionOmics

Gene overview

TkA04G126480

Reference: TK1151 Chr: Chr04 Coordinates: 32843896-32846653 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1295 bp · TkA04G126480|TK1151|cDNA

CAACGGCGGTCAAAACGACCTTCCGTTTGGTACTGGACTCATTGGAGACACCGATTCATTCACGAGAAGGTGGCAGAAGCTCTTCACTGCGAGTGAGTGATCCTAAAAATGCTGTCGATCGTCTTGTCTTCCGTGATTCTTGCGGTGGTTGTAACTTTTTCTCACAAATTTCTCACAGGCGATGGTGATTTCACATTGCTGTCAAAAGGAAAAGTAAAGCGCGAAAGTTTTCAAGATAAGGTTGTCTGGATTACTGGAGC...

CDS

Download CDS FASTA

1020 bp · TkA04G126480|TK1151|CDS

ATGGAGCGGGGCAACGGCGGTCAAAACGACCTTCCGTTTGGTACTGGACTCATTGGAGACACCGATTCATTCACGAGAAGGTGGCAGAAGCTCTTCACTGCGAGTGATTTCACATTGCTGTCAAAAGGAAAAGTAAAGCGCGAAAGTTTTCAAGATAAGGTTGTCTGGATTACTGGAGCAAGTCGGGGAATTGGCGAGGTTCTTGCCAAGCAACTTGCAACTCTAGGAGCCAAGTTAATTATTTCTGCAAGAAACGAACC...

Protein

Download Protein FASTA

339 aa · TkA04G126480|TK1151|PROTEIN

MERGNGGQNDLPFGTGLIGDTDSFTRRWQKLFTASDFTLLSKGKVKRESFQDKVVWITGASRGIGEVLAKQLATLGAKLIISARNEPELERVKKQISDLNLGKHGLEGVEILPLDLSSGEDAIREVVEKAISLFGGAGVDYVIHNAAFERPKSTALDVPESSLKATLDVNVMGPISLTRLLLPHMLKKGRGHFVVMSSAAGKVPAPGQAVYSASKFALNGYFHSLRSEFYQKGIMVTVVCPGPIETSNAPDTTTSGQKSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G126480`
TK1151 ID	TkA04G126480
OH-1004 ID	LXL04_035504
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G126480`
Location	Chr04:32843896-32846653 (-)
Description	Similar to DHRS7: Dehydrogenase/reductase SDR family member 7
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035504` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006629 lipid metabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005778 peroxisomal membrane Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0000140 acylglycerone-phosphate reductase (NADP+) activity Molecular Function GO:0004090 carbonyl reductase (NADPH) activity Molecular Function GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function GO:0052650 all-trans-retinol dehydrogenase (NADP+) activity Molecular Function
KEGG gene cross-reference	bsu:BSU23780 dme:Dmel_CG7601 hsa:51635 mmu:66375 xla:779313 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.286

Rank 1 · TkA04G126480 · TK1151

Mitochondrion0.277

Rank 2 · TkA04G126480 · TK1151

Peroxisome0.186

Rank 3 · TkA04G126480 · TK1151

Cytoplasm0.143

Rank 4 · TkA04G126480 · TK1151

Nucleus0.079

Rank 5 · TkA04G126480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short53-250 aa

PF08659KR55-227 aa

PF02719Polysacc_synt_255-239 aa

PF01370Epimerase56-229 aa

PF13561adh_short_C259-254 aa

PF13460NAD_binding_1059-277 aa

PF08643DUF1776157-259 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G126480	`PF00106`	adh_short	53	250	5.8e-46	157.2
TkA04G126480	`PF08659`	KR	55	227	1.8e-13	51.5
TkA04G126480	`PF02719`	Polysacc_synt_2	55	239	0.0014	18.6
TkA04G126480	`PF01370`	Epimerase	56	229	0.00025	21.2
TkA04G126480	`PF13561`	adh_short_C2	59	254	2.5e-33	116.3
TkA04G126480	`PF13460`	NAD_binding_10	59	277	5.3e-05	23.9
TkA04G126480	`PF08643`	DUF1776	157	259	0.033	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card