TkA04G121620 | RubberDandelionOmics

Gene overview

TkA04G121620

Reference: TK1151 Chr: Chr04 Coordinates: 31597793-31599025 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1059 bp · TkA04G121620|TK1151|cDNA

AAATTTTCATCCTTTGAAATCAAAACCTTCCTTCAACGAATAAACGATCTCTACCTTTACCCAATTCTAATGGCTGAAATCGCTGTTACCGCCGTCATCACTGTGCTGTGTGAGAAGCTGATCTCTGGTGACTTGATGAAGCTTGCTCGATCCGAAGGAATCGATTCTCAGCTGCAGAAATGGAAGAAGAACTTGCTGCTGATCCAAGCCTTGCTGGCCGATGCAAGCCAGAAGCATATCAAAGACAAAGCTGTTCAATT...

CDS

Download CDS FASTA

990 bp · TkA04G121620|TK1151|CDS

ATGGCTGAAATCGCTGTTACCGCCGTCATCACTGTGCTGTGTGAGAAGCTGATCTCTGGTGACTTGATGAAGCTTGCTCGATCCGAAGGAATCGATTCTCAGCTGCAGAAATGGAAGAAGAACTTGCTGCTGATCCAAGCCTTGCTGGCCGATGCAAGCCAGAAGCATATCAAAGACAAAGCTGTTCAATTATGGGTGAATGATCTGGAGGATTTGGCTTACGATATAGACGATGTACTCGATGAAATGGCCACAGAAAC...

Protein

Download Protein FASTA

330 aa · TkA04G121620|TK1151|PROTEIN

MAEIAVTAVITVLCEKLISGDLMKLARSEGIDSQLQKWKKNLLLIQALLADASQKHIKDKAVQLWVNDLEDLAYDIDDVLDEMATETIRRRLNQEASSSTSMITERRLEQTSLVDESKIMGREKDKAALLGKLLENGENVRIVSIIGMGGIGKTTIAKLLYNEEKVKGHFGVRAWVCVSEELDVFNISKAIFQAVTGVNQDFANLDLLHVALKENLSKKRFLLVLDDVWNEDHSKWELLQNPLLVGAAGSKIIVTTRSTT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G121620`
TK1151 ID	TkA04G121620
OH-1004 ID	LXL04_016183
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.200
Protein coverage (%)	TK1151 100.000 / OH-1004 28.719 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G121620

Location Chr04:31597793-31599025 (-)

Description Similar to RPPL1: Putative disease resistance RPP13-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016183 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051607 defense response to virus Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0004016 adenylate cyclase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G14460

ath:AT3G14470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.650

Rank 1 · TkA04G121620 · TK1151

Endoplasmic reticulum0.139

Rank 2 · TkA04G121620 · TK1151

Cytoplasm0.124

Rank 3 · TkA04G121620 · TK1151

Lysosome / Vacuole0.074

Rank 4 · TkA04G121620 · TK1151

Plastid0.039

Rank 5 · TkA04G121620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052Rx_N5-97 aa

PF19993DO-GTPase26-111 aa

PF06491Disulph_isomer9-126 aa

PF00005ABC_tran39-91 aa

PF13191AAA_1646-79 aa

PF00931NB-ARC76-111 aa

PF20720nSTAND376-96 aa

PF13238AAA_1876-97 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G121620	`PF18052`	Rx_N	5	97	2.6e-20	73.0
TkA04G121620	`PF19993`	DO-GTPase2	6	111	0.44	10.9
TkA04G121620	`PF06491`	Disulph_isomer	9	126	0.27	12.1
TkA04G121620	`PF00005`	ABC_tran	39	91	0.045	15.1
TkA04G121620	`PF13191`	AAA_16	46	79	4.2e-05	24.8
TkA04G121620	`PF00931`	NB-ARC	76	111	5.7e-38	130.9
TkA04G121620	`PF20720`	nSTAND3	76	96	0.0037	17.7
TkA04G121620	`PF13238`	AAA_18	76	97	0.036	15.3
TkA04G121620	`PF13401`	AAA_22	82	93	0.0045	18.0
TkA04G121620	`PF13238`	AAA_18	99	126	0.036	15.3
TkA04G121620	`PF13191`	AAA_16	120	240	4.2e-05	24.8
TkA04G121620	`PF25201`	nSTAND6	121	190	0.07	13.9
TkA04G121620	`PF00931`	NB-ARC	123	290	5.7e-38	130.9
TkA04G121620	`PF25199`	nSTAND_NTPase5	128	156	0.21	12.1
TkA04G121620	`PF20720`	nSTAND3	138	192	0.0037	17.7
TkA04G121620	`PF13401`	AAA_22	141	228	0.0045	18.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRR4`	Arabidopsis thaliana	sp\|Q9LRR4\|R13L1_ARATH Putative disease resistance RPP13-like protein 1	46.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card