TkA04G108430 | RubberDandelionOmics

Gene overview

TkA04G108430

Reference: TK1151 Chr: Chr04 Coordinates: 28177523-28179436 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1849 bp · TkA04G108430|TK1151|cDNA

AAAAAAAAATCGAGTGTTTAGAAAGTAAATAAAACGAGTAATTTGCACTTCTCCTCTAATAACACCTCCCCTATTTAAACTATAAAGTGTTTAGCCATTTATGTATAAACATTGAGCACCTTCGTTTGGTTAACCACAACATCATCTTAAAACCTCTCCTAACCATGGCGGATTTCCATGGCTACTTCACCCTCATTCTCATGTCCCTGATCTCCATCATCTTAATCGCAGCATTATTCAAATCAACTCGTGCTAAATCT...

CDS

Download CDS FASTA

966 bp · TkA04G108430|TK1151|CDS

ATGACAAACAATGTAACATCAAGAATGCTTATGAGCAAGAGGTGTTCAGAAGAAAAGGATAAGGCGGAAGACATAAGGCAAATAATTACCGAAATTGGGGAGCTTATCAGTAAATTTAACCTTTCGGATCATATATGGTTCTGTAAGTATTTTGACTTTCAGGGAATCGGAAAAAGGTCAACGGATATGTGTAGAAGATTCGATGACTTGATAGAAAGTATCATTAAAGAACATGAAGAAGCAACGGAAGAACAGAAAGA...

Protein

Download Protein FASTA

321 aa · TkA04G108430|TK1151|PROTEIN

MTNNVTSRMLMSKRCSEEKDKAEDIRQIITEIGELISKFNLSDHIWFCKYFDFQGIGKRSTDMCRRFDDLIESIIKEHEEATEEQKDLLNILLHISEDENMEKKLTRENIKAFILDVFGAGTDTSALTTEWALSELINHPDIMKKAVEEIDHVVGKKRLLQESDIPNLPYLQSIVKETLRIHPTVPLIQRLSTRDCIIGGYHIPAKTTIFFNVWGHGRDPANWENPLEFRPERFEGRKVDVRGQHFQLLPFGSGSRMCPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G108430`
TK1151 ID	TkA04G108430
OH-1004 ID	LXL04_035791
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 64.200 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G108430`
Location	Chr04:28177523-28179436 (+)
Description	Similar to CYP93A1: 3,9-dihydroxypterocarpan 6A-monooxygenase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035791` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006952 defense response Biological Process GO:0009813 flavonoid biosynthetic process Biological Process GO:0016020 membrane Cellular Component GO:0005506 iron ion binding Molecular Function GO:0016709 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen Molecular Function GO:0016712 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen Molecular Function GO:0020037 heme binding Molecular Function GO:0033771 flavanone 2-hydroxylase activity Molecular Function GO:0047082 3,9-dihydroxypterocarpan 6a-monooxygenase activity Molecular Function GO:0102469 naringenin 2-hydroxylase activity Molecular Function
KEGG gene cross-reference	ag:BAA22423 gmx:100037459 gmx:100776878 gmx:100797067 gmx:100815706 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.923

Rank 1 · TkA04G108430 · TK1151

Cytoplasm0.041

Rank 2 · TkA04G108430 · TK1151

Cell membrane0.037

Rank 3 · TkA04G108430 · TK1151

Mitochondrion0.024

Rank 4 · TkA04G108430 · TK1151

Plastid0.020

Rank 5 · TkA04G108430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p4502-310 aa

PF23219LAMB13-36 aa

PF26091PWI_CCDC4317-34 aa

PF27494Y4lK21-32 aa

PF25968CALS123-97 aa

PF26091PWI_CCDC4367-103 aa

PF23219LAMB182-155 aa

PF27494Y4lK108-165 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G108430	`PF00067`	p450	2	310	2.5e-81	274.5
TkA04G108430	`PF23219`	LAMB1	3	36	0.59	10.6
TkA04G108430	`PF26091`	PWI_CCDC43	17	34	2.4	9.1
TkA04G108430	`PF27494`	Y4lK	21	32	0.024	15.4
TkA04G108430	`PF25968`	CALS1	23	97	0.48	10.9
TkA04G108430	`PF26091`	PWI_CCDC43	67	103	2.4	9.1
TkA04G108430	`PF23219`	LAMB1	82	155	0.59	10.6
TkA04G108430	`PF27494`	Y4lK	108	165	0.024	15.4
TkA04G108430	`PF18312`	ScsC_N	136	149	0.14	12.6
TkA04G108430	`PF25968`	CALS1	141	177	0.48	10.9
TkA04G108430	`PF18312`	ScsC_N	172	185	0.14	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card