TkA04G102660 | RubberDandelionOmics

Gene overview

TkA04G102660

Reference: TK1151 Chr: Chr04 Coordinates: 26689569-26697057 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1281 bp · TkA04G102660|TK1151|cDNA

ATGAACCAAGATATGTGGTGGATGAGCGAAAATCATGAATCCAATCATTATAGTAACAACTCATATGACGATGAGTTTTACGATAATGGGTGCGATTATGGTGATCCATATGAATCATACGAGAATAATTGGCTGTGGACCGACAATTCAGTCCAAAATCAATATCAAGAGTCGCCTTATTTCTTAGAAAATCAAGAAAGATCAAACGAATATTCGTCCGATGATAAGTTGGACCAAATGTTGGATATGATGATGAAATC...

CDS

Download CDS FASTA

1281 bp · TkA04G102660|TK1151|CDS

ATGAACCAAGATATGTGGTGGATGAGCGAAAATCATGAATCCAATCATTATAGTAACAACTCATATGACGATGAGTTTTACGATAATGGGTGCGATTATGGTGATCCATATGAATCATACGAGAATAATTGGCTGTGGACCGACAATTCAGTCCAAAATCAATATCAAGAGTCGCCTTATTTCTTAGAAAATCAAGAAAGATCAAACGAATATTCGTCCGATGATAAGTTGGACCAAATGTTGGATATGATGATGAAATC...

Protein

Download Protein FASTA

426 aa · TkA04G102660|TK1151|PROTEIN

MNQDMWWMSENHESNHYSNNSYDDEFYDNGCDYGDPYESYENNWLWTDNSVQNQYQESPYFLENQERSNEYSSDDKLDQMLDMMMKSFDMQEKSESYENNWQWTDNSVQNQYQESPYFLENQERSNEYSSDDKLDQMLDMMMKSFDMQEKSLSNIQRSIEYISEQLNQQSSDNISDTTHEYEDTKMHKPTPPELEVVVEDYVSLNDKKTEKRPENEEVEIGSENNQINYEPIIPKVGEGLVEVHTTSSPTTLSKPDAQPF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G102660`
TK1151 ID	TkA04G102660
OH-1004 ID	LXL04_016024
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	62.000
Protein coverage (%)	TK1151 99.765 / OH-1004 45.165 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G102660`
Location	Chr04:26689569-26697057 (-)
Description	Similar to PPOX1: Pyridoxine/pyridoxamine 5'-phosphate oxidase 1, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_016024` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006739 NADP+ metabolic process Biological Process GO:0006869 lipid transport Biological Process GO:0008615 pyridoxine biosynthetic process Biological Process GO:0010874 regulation of cholesterol efflux Biological Process GO:0019674 NAD+ metabolic process Biological Process GO:0031580 membrane raft distribution Biological Process GO:0046496 nicotinamide nucleotide metabolic process Biological Process GO:0110051 metabolite repair Biological Process GO:0005576 extracellular region Cellular Component GO:0005615 extracellular space Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	ath:AT5G49970 isc:8039603 mmu:246703 rno:295229 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.406

Rank 1 · TkA04G102660 · TK1151

Nucleus0.361

Rank 2 · TkA04G102660 · TK1151

Cell membrane0.134

Rank 3 · TkA04G102660 · TK1151

Endoplasmic reticulum0.111

Rank 4 · TkA04G102660 · TK1151

Mitochondrion0.105

Rank 5 · TkA04G102660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03961FapA62-115 aa

PF28067XopA_Hpa165-108 aa

PF13618Gluconate_2-dh378-124 aa

PF03961FapA89-187 aa

PF28067XopA_Hpa1122-148 aa

PF13618Gluconate_2-dh3135-181 aa

PF23949TSTD2_N371-399 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G102660	`PF03961`	FapA	62	115	2.3	8.5
TkA04G102660	`PF28067`	XopA_Hpa1	65	108	2.5	8.8
TkA04G102660	`PF13618`	Gluconate_2-dh3	78	124	0.54	11.3
TkA04G102660	`PF03961`	FapA	89	187	2.3	8.5
TkA04G102660	`PF28067`	XopA_Hpa1	122	148	2.5	8.8
TkA04G102660	`PF13618`	Gluconate_2-dh3	135	181	0.54	11.3
TkA04G102660	`PF23949`	TSTD2_N	371	399	0.72	10.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card