TkA04G085180 | RubberDandelionOmics

Gene overview

TkA04G085180

Reference: TK1151 Chr: Chr04 Coordinates: 22330133-22332948 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1331 bp · TkA04G085180|TK1151|cDNA

AGAACCAAGTTGGAATCACATGTGGTTTTGGGACTGATTTATGTCCGTTTAAAGAACCATTGTGATTTGTGTGATTCCAATGAAATTCTTGAAATCATATTCGTAGTGTTTTGTAATGCGGCGGAAATTGAATATTTCATCCCACAATTTCAGCAAATTGAATCCGTCATCCGAAAATGGCTGGAATCGGTGCATGAAAAGTTCAAGTTCTTCCCCGATGCGTCGTTTCCATCTACGGGTAAATCTAAGGTTGAAGTTGG...

CDS

Download CDS FASTA

834 bp · TkA04G085180|TK1151|CDS

AGAACCAAGTTGGAATCACATGTGGTTTTGGGACTGATTTATGTCCGTTTAAAGAACCATTGTGATTTGTGTGATTCCAATGAAATTCTTGAAATCATATTCGTAGTGTTTTGTAATGCGGCGGAAATTGAATATTTCATCCCACAATTTCAGCAAATTGAATCCGTCATCCGAAAATGGCTGGAATCGGTGCATGAAAAGTTCAAGTTCTTCCCCGATGCGTCGTTTCCATCTACGGGTAAATCTAAGGTTGAAGTTGG...

Protein

Download Protein FASTA

277 aa · TkA04G085180|TK1151|PROTEIN

RTKLESHVVLGLIYVRLKNHCDLCDSNEILEIIFVVFCNAAEIEYFIPQFQQIESVIRKWLESVHEKFKFFPDASFPSTGKSKVEVGRGRYFSTESNKIDEPLKVQEAETINPPPPPEEKLLVVGGNGFVGSHICKEALDRGLSVASLSRSGKSSIQDPWATKVSWHKGDLLSGDSWKDALTGVTSVISCVGGFGSNTFMYKINGTANINAIRAATEKGIKRFVYISASDFGVIIESISLSVDSLELKRVSTRVVKRSGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G085180`
TK1151 ID	TkA04G085180
OH-1004 ID	LXL04_029100
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.600
Protein coverage (%)	TK1151 53.791 / OH-1004 52.465 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G085180

Location Chr04:22330133-22332948 (-)

Description Similar to At1g32220: Uncharacterized protein At1g32220, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32220`	Uncharacterized protein At1g32220, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029100 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006695 cholesterol biosynthetic process Biological Process

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0008203 cholesterol metabolic process Biological Process

GO:0015979 photosynthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G32220

bta:616694

sce:YLR290C

spo:2538806

syn:slr0399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.917

Rank 1 · TkA04G085180 · TK1151

Mitochondrion0.088

Rank 2 · TkA04G085180 · TK1151

Cytoplasm0.047

Rank 3 · TkA04G085180 · TK1151

Nucleus0.043

Rank 4 · TkA04G085180 · TK1151

Cell membrane0.017

Rank 5 · TkA04G085180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368NmrA118-227 aa

PF04321RmlD_sub_bind120-159 aa

PF01370Epimerase122-229 aa

PF010733Beta_HSD122-230 aa

PF16363GDP_Man_Dehyd122-184 aa

PF13460NAD_binding_10125-232 aa

PF04321RmlD_sub_bind201-228 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G085180	`PF05368`	NmrA	118	227	5.1e-09	36.9
TkA04G085180	`PF04321`	RmlD_sub_bind	120	159	0.042	13.6
TkA04G085180	`PF01370`	Epimerase	122	229	6.1e-13	49.5
TkA04G085180	`PF01073`	3Beta_HSD	122	230	1.1e-09	38.5
TkA04G085180	`PF16363`	GDP_Man_Dehyd	122	184	0.00028	21.2
TkA04G085180	`PF13460`	NAD_binding_10	125	232	1.4e-15	58.3
TkA04G085180	`PF04321`	RmlD_sub_bind	201	228	0.042	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FVR6`	Arabidopsis thaliana	sp\|Q9FVR6\|Y1222_ARATH Uncharacterized protein At1g32220, chloroplastic	45.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card