TkA04G084960 | RubberDandelionOmics

Gene overview

TkA04G084960

Reference: TK1151 Chr: Chr04 Coordinates: 22266141-22271179 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1779 bp · TkA04G084960|TK1151|cDNA

ATTTTTCACCTTACATTTTAAGGGGTTTAAAGGACATTTCAAATCATTCTCTCTCCGGCAAATAAATACCCATGCAAACATTTATGGATCAAAGAGATCGAGGGGAGCATATATATAGAGAGGAGAGAAAGACGACGGAGAGTTATGGAGGAGGGATATTATGTCAGATTAGAGGATGAAGACCTCCATCTCCGTCATCATCATGAAGATCCTATCCCTACCTCTCTTCTTCTTTCTCTATATGTCGGACACTTCTTAGC...

CDS

Download CDS FASTA

1533 bp · TkA04G084960|TK1151|CDS

ATGGAGGAGGGATATTATGTCAGATTAGAGGATGAAGACCTCCATCTCCGTCATCATCATGAAGATCCTATCCCTACCTCTCTTCTTCTTTCTCTATATGTCGGACACTTCTTAGCCAGATGGGGTGCCAGGACATGGGAATTCTCGGTCGGATTGTACATGATAAGCGTATGGCCAGATTCTTTGCTTATGGCTGCAGCCTATGGTGTGGTCGAGTCGGCAGCTACCACGTTATTTGGTCCGCTTGTTGGGCAGTGGGT...

Protein

Download Protein FASTA

510 aa · TkA04G084960|TK1151|PROTEIN

MEEGYYVRLEDEDLHLRHHHEDPIPTSLLLSLYVGHFLARWGARTWEFSVGLYMISVWPDSLLMAAAYGVVESAATTLFGPLVGQWVDNSTYPKVLRIWLITQNLSFIIAGITVVGLLICPDMRVTNVTAFTVLVVLTNLSGAIAVLSTLAGTILIEREWVVVISEGSSNLLTKMNSRIRRIDLICKLFAPVVSGFIISFVSMIASAATLAIWNILSVFFQYWLLNSVYKGIPALQESSKRRGLKSTISTTDQDQTSPST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G084960`
TK1151 ID	TkA04G084960
OH-1004 ID	LXL04_019484
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	25.900
Protein coverage (%)	TK1151 89.608 / OH-1004 73.424 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G084960

Location Chr04:22266141-22271179 (-)

Description Similar to IREG3: Solute carrier family 40 member 3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03570`	Vacuolar transporter that is involved in the transport of excess nickel into the vacuole under iron deficiency, increasing cellular tolerance to nickel under iron deficiency stress response.	AtIREG2 encodes a tonoplast transport protein involved in iron-dependent nickel detoxification in Arabidopsis thaliana roots.2006 · DOI: 10.1074/jbc.m601062200
`At2g38460`	May be involved in iron transport and iron homeostasis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0560000`	May be involved in iron transport and iron homeostasis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019484 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006824 cobalt ion transport Biological Process

GO:0006826 iron ion transport Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016020 membrane Cellular Component

GO:0005381 iron ion transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G38460

ath:AT5G26820

dosa:Os06g0560000

dosa:Os12g0562100

osa:107276535

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.520

Rank 1 · TkA04G084960 · TK1151

Cell membrane0.169

Rank 2 · TkA04G084960 · TK1151

Cytoplasm0.162

Rank 3 · TkA04G084960 · TK1151

Endoplasmic reticulum0.161

Rank 4 · TkA04G084960 · TK1151

Golgi apparatus0.132

Rank 5 · TkA04G084960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06963FPN127-478 aa

PF29575Fz_Smo_sans_CRD_N264-278 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G084960	`PF06963`	FPN1	27	478	5.6e-157	523.5
TkA04G084960	`PF29575`	Fz_Smo_sans_CRD_N	264	278	0.23	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KGN5`	Arabidopsis thaliana	sp\|F4KGN5\|S40A2_ARATH Solute carrier family 40 member 2	62.300%	Swiss-Prot	High
`O80905`	Arabidopsis thaliana	sp\|O80905\|S40A1_ARATH Solute carrier family 40 member 1	59.000%	Swiss-Prot	High
`Q5Z922`	Oryza sativa subsp. japonica	sp\|Q5Z922\|S40A1_ORYSJ Solute carrier family 40 member 1	57.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card