Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2677 bp · TkA04G082310|TK1151|cDNA
GGCACACTTCTCGTCTAATCCGAAACTAAACCTCTCGCCCTCGTTCTCGTTCTCGTTCTCGTTCTCGTCGTCTCTCTCGTTCCGTGTTGTTCACGGCTTCAGAAACTAAAACTTTCGCACAGACGCACGTCGCACAGAACACATCGCCACACACAGCAGCAGCTCCGAGTTCCTCCTCCCCTGTCGCTGCCAGCCGCCGATCCCAGCCACATCCACCTCCGATTCGACCTACGACACGCACTGGTTAGCAGTTATGGAAG...
2493 bp · TkA04G082310|TK1151|CDS
ATGGAAGAAGACCAAGAAAGGGAAAGATTTGGCATGGAGAACGACTACGAAGGCGGGCAATGGAAAGGTGGCGAATTCTATTATGGAAAGCGAAAGGAAAAACACCACCAGACCAAAGATGATCAGCTATACGGTATCTTTGCTTCTGGTGACTCGGATAGTGACTCAGAAGGCAGCTCCAAGAAAAGACGAAAAAAAGTTTTATCCAAAAAACAACAAGATCTCACCAAACCCCTCAATTTTGTATCAAGTGGGATTGT...
Protein
Download Protein FASTA830 aa · TkA04G082310|TK1151|PROTEIN
MEEDQERERFGMENDYEGGQWKGGEFYYGKRKEKHHQTKDDQLYGIFASGDSDSDSEGSSKKRRKKVLSKKQQDLTKPLNFVSSGIVMPNEEIDDITKQEKQKDDQDDNSHPGLGQGLGFNSDKKEVNETPIDFLPTAFGKMIKEGALQRREKEIEKSRLTKKSTNLGLGKREAKDDGNVGVFEKHTKGIGMKLLEKMGYKGGGLGRNAQGIVAPIEAKLRPKNMGMGFNDYKEAANAPTLLESTDEIKVLTQTMTQQKE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G082310 |
|---|---|
| TK1151 ID | TkA04G082310 |
| OH-1004 ID | LXL04_036047 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 93.400 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G082310 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:21573884-21578141 (+) | |||||||||
| Description | Similar to STIPL1: Septin and tuftelin-interacting protein 1 homolog 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000390 spliceosomal complex disassembly Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0042752 regulation of circadian rhythm Biological Process GO:0005634 nucleus Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0005737 cytoplasm Cellular Component GO:0031981 nuclear lumen Cellular Component GO:0071008 U2-type post-mRNA release spliceosomal complex Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003677 DNA binding Molecular Function GO:1990446 U1 snRNP binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G17070 ath:AT2G42330 bta:509349 xla:447466 xtr:100038256 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12457TIP_N4-109 aaPF12656G-patch_296-123 aaPF01585G-patch115-121 aaPF12656G-patch_2152-173 aaPF12457TIP_N171-184 aaPF01585G-patch187-228 aaPF12656G-patch_2190-230 aaPF29438AtMg01310237-266 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G082310 | PF12457 | TIP_N | 4 | 109 | 6.2e-22 | 78.6 |
| TkA04G082310 | PF12656 | G-patch_2 | 96 | 123 | 4.8e-05 | 24.0 |
| TkA04G082310 | PF01585 | G-patch | 115 | 121 | 2.5e-14 | 53.6 |
| TkA04G082310 | PF12656 | G-patch_2 | 152 | 173 | 4.8e-05 | 24.0 |
| TkA04G082310 | PF12457 | TIP_N | 171 | 184 | 6.2e-22 | 78.6 |
| TkA04G082310 | PF01585 | G-patch | 187 | 228 | 2.5e-14 | 53.6 |
| TkA04G082310 | PF12656 | G-patch_2 | 190 | 230 | 4.8e-05 | 24.0 |
| TkA04G082310 | PF29438 | AtMg01310 | 237 | 266 | 0.15 | 12.9 |
| TkA04G082310 | PF27698 | Asteroid_N | 257 | 276 | 8.2 | 7.0 |
| TkA04G082310 | PF27698 | Asteroid_N | 325 | 398 | 8.2 | 7.0 |
| TkA04G082310 | PF07842 | GCFC | 405 | 666 | 1.7e-79 | 268.0 |
| TkA04G082310 | PF29438 | AtMg01310 | 544 | 583 | 0.15 | 12.9 |
| TkA04G082310 | PF27698 | Asteroid_N | 651 | 672 | 8.2 | 7.0 |
| TkA04G082310 | PF31031 | TFIP11_C | 758 | 819 | 0.044 | 14.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.