Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2434 bp · TkA04G067360|TK1151|cDNA
GTTGCCTTGATGGGGTCCATACTCCATAAGCATTCGTTTAAGCAAACTATTTTTTTGTTGAAATGGATAAGCTTTGTTTTGCTTACGTTTAAGCAAAGACAAAACATGGCATCTTAAACTAGCAATCGTTGTGTTCACAAAAGCCATTTTTGATTTTTTTTTCCCTTTTCCCTCAATCAAATATTCAAACGCCATATTCTTCATGCCATCCCTGTAGTTCTTTGCCGACTGCATTTATCGGAAGCACAACAAAATGGGTC...
1707 bp · TkA04G067360|TK1151|CDS
ATGGGTCCAAGAAATGATCCTGGAGCTGTGATACTTGGGCTTATTATTGGGCTTTCTACATTCATTCATTGTACATCAACATTAACGGATACAAATGCATTGCTGTCTGTAAATGCTTCTCAAGAATCCACTAGGAAAATGCCAGATAATCTATTTGGTGTTTCCTTTGAGGAGATCAACCATGCTGGTGCAGGCGGTTTGTGGGGAGAGTTGGTAAACAACCGAGGGTTCGAATCTGGTGGACGACATTCTCCATCTAT...
Protein
Download Protein FASTA568 aa · TkA04G067360|TK1151|PROTEIN
MGPRNDPGAVILGLIIGLSTFIHCTSTLTDTNALLSVNASQESTRKMPDNLFGVSFEEINHAGAGGLWGELVNNRGFESGGRHSPSIIDPWSTIGNYSFVRISTDLSSCFNRNPVAMRMEVLCDTSGPNACPAGGVGIYNPGYWGMNIERGKMYKLVVYIRSLDQVNIMVSLSDSTGVKTLATVNIKIKANDVSNWKKMEVVFKAKTTNHNSRLQLTTNKKGIIWFDQVSLMPMDTYKGHGYRNDLFKMVADLKPGFIRF...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G067360 |
|---|---|
| TK1151 ID | TkA04G067360 |
| OH-1004 ID | LXL04_019305 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 72.200 |
| Protein coverage (%) | TK1151 93.662 / OH-1004 79.254Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G067360 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:17856826-17863561 (+) | |||||||||
| Description | Similar to ASD1: Alpha-L-arabinofuranosidase 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0019566 arabinose metabolic process Biological Process GO:0031222 arabinan catabolic process Biological Process GO:0045493 xylan catabolic process Biological Process GO:0046373 L-arabinose metabolic process Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005576 extracellular region Cellular Component GO:0048046 apoplast Cellular Component GO:0099503 secretory vesicle Cellular Component GO:0009044 xylan 1,4-beta-xylosidase activity Molecular Function GO:0046556 alpha-L-arabinofuranosidase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT3G10740 ath:AT5G26120 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02018CBM_4_970-105 aaPF03422CBM_6136-228 aaPF02018CBM_4_9147-218 aaPF06964Alpha-L-AF_C182-211 aaPF22848ASD1_dom250-451 aaPF06964Alpha-L-AF_C469-531 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G067360 | PF02018 | CBM_4_9 | 70 | 105 | 0.0055 | 17.8 |
| TkA04G067360 | PF03422 | CBM_6 | 136 | 228 | 0.051 | 14.6 |
| TkA04G067360 | PF02018 | CBM_4_9 | 147 | 218 | 0.0055 | 17.8 |
| TkA04G067360 | PF06964 | Alpha-L-AF_C | 182 | 211 | 2.1e-10 | 41.8 |
| TkA04G067360 | PF22848 | ASD1_dom | 250 | 451 | 8.1e-58 | 196.2 |
| TkA04G067360 | PF06964 | Alpha-L-AF_C | 469 | 531 | 2.1e-10 | 41.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.