TkA04G064370 | RubberDandelionOmics

Gene overview

TkA04G064370

Reference: TK1151 Chr: Chr04 Coordinates: 17144969-17150119 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3264 bp · TkA04G064370|TK1151|cDNA

TTGGTCTTTAACATTCTGTTTTCGAGTTTACTTATTTTTACACTCCTTTTTCTTTTTTTCTTTTAAAACTTGGAAGCAACACTAACAAAACTGAAACGGCGGCGTTTGTTTCCGAACACAGGTTTCCCTCGCACATGGTTGCTCACTCATACTGACCTGAACGCCGACGAACAGCACAAGCAGCTCAGGGGTTTTATTAGCTGCAGAAATGGCAGGGATCGTGAAGCCACAAAGTGGGTTTGTAATTACACCCCACAAAG...

CDS

Download CDS FASTA

2739 bp · TkA04G064370|TK1151|CDS

ATGGCAGGGATCGTGAAGCCACAAAGTGGGTTTGTAATTACACCCCACAAAGTATCGATCTGTATACTTGTTCAGGTTTATGCTCCTTCCGGTCAATTTTCTGTACCGTTCCCTTTTGCCTCGATTACCCAGCATAATCGTCTCGGATTGTTCTTGATTGCTCTTACAAAGTCATGTGATGACATTTTGGAGCCAACATTGGATGAATTCCTGAAGCTACTCAAGGAATTTGGTGGATTATTAGATAATTGGTTAAGTGA...

Protein

Download Protein FASTA

912 aa · TkA04G064370|TK1151|PROTEIN

MAGIVKPQSGFVITPHKVSICILVQVYAPSGQFSVPFPFASITQHNRLGLFLIALTKSCDDILEPTLDEFLKLLKEFGGLLDNWLSDHVTSRLSSLSSPDDLFTFFNELRGILAGPETTIVDDDQINLDPNSNLGMYLRRCLLAFNVLSFEGMCHLLTNIKTYYKEAISSCPPYEMTHLDDSSNDQEAPLEYENMDLENFVLKNFTEELESRKRVPFHNHSSKALFNLIEDIKVSRGQKVKHSHRSPEVSPNIESSDVIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G064370`
TK1151 ID	TkA04G064370
OH-1004 ID	LXL04_036200
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 98.482 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G064370

Location Chr04:17144969-17150119 (+)

Description Similar to APC5: Anaphase-promoting complex subunit 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g06590`	Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin-protein ligase complex that controls progression through mitosis and the G1 phase of the cell cycle.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036200 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0031145 anaphase-promoting complex-dependent catabolic process Biological Process

GO:0045842 positive regulation of mitotic metaphase/anaphase transition Biological Process

GO:0051301 cell division Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

GO:0070979 protein K11-linked ubiquitination Biological Process

GO:0141198 protein branched polyubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005680 anaphase-promoting complex Cellular Component

GO:0005819 spindle Cellular Component

GO:0019903 protein phosphatase binding Molecular Function

KEGG gene cross-reference

ath:AT1G06590

mmu:59008

rno:288671

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.475

Rank 1 · TkA04G064370 · TK1151

Nucleus0.448

Rank 2 · TkA04G064370 · TK1151

Golgi apparatus0.068

Rank 3 · TkA04G064370 · TK1151

Cell membrane0.065

Rank 4 · TkA04G064370 · TK1151

Mitochondrion0.059

Rank 5 · TkA04G064370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21371Apc5_N13-166 aa

PF13181TPR_8161-172 aa

PF07719TPR_2162-172 aa

PF00515TPR_1163-169 aa

PF12862ANAPC5312-412 aa

PF14559TPR_19324-339 aa

PF21033RMD1-3358-398 aa

PF13424TPR_12362-392 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G064370	`PF21371`	Apc5_N	13	166	0.00053	20.9
TkA04G064370	`PF13181`	TPR_8	161	172	0.0009	19.9
TkA04G064370	`PF07719`	TPR_2	162	172	0.013	16.3
TkA04G064370	`PF00515`	TPR_1	163	169	0.00077	19.9
TkA04G064370	`PF12862`	ANAPC5	312	412	8.8e-23	80.9
TkA04G064370	`PF14559`	TPR_19	324	339	2.6	9.1
TkA04G064370	`PF21033`	RMD1-3	358	398	0.085	12.7
TkA04G064370	`PF13424`	TPR_12	362	392	0.18	12.7
TkA04G064370	`PF00515`	TPR_1	363	392	0.00077	19.9
TkA04G064370	`PF13181`	TPR_8	363	393	0.0009	19.9
TkA04G064370	`PF07719`	TPR_2	363	392	0.013	16.3
TkA04G064370	`PF13428`	TPR_14	363	394	0.06	14.8
TkA04G064370	`PF14559`	TPR_19	375	397	2.6	9.1
TkA04G064370	`PF14559`	TPR_19	697	719	2.6	9.1
TkA04G064370	`PF13428`	TPR_14	698	723	0.06	14.8
TkA04G064370	`PF13424`	TPR_12	702	718	0.18	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1U4`	Arabidopsis thaliana	sp\|Q8H1U4\|APC5_ARATH Anaphase-promoting complex subunit 5	59.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card