RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G062140
Reference: TK1151 Chr: Chr04 Coordinates: 16565343-16575675 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1846 bp · TkA04G062140|TK1151|cDNA

GCAAGAAGGAAAAAACATATTATTGGCTCACTCACCATCTCAAAAGTTAAAAGTGGCCTCAAATCAGAACCTCCACCCAACTATCAAATCCCAAAAATGGACGGCGACAAAAGAAACGCTACAACACACTCGCCGGTAGCCGAAGTGGTGGTGGTGATGGTGCCCTTCATAGCTCATGGCCATCTCAACCAGCTCCTACACCTCTCCCGCGTTATATCCAATTACAACATCCCCGTCCACTACATAAGCTTCACCACTCA...

CDS

Download CDS FASTA

1518 bp · TkA04G062140|TK1151|CDS

GCAAGAAGGAAAAAACATATTATTGGCTCACTCACCATCTCAAAAGTTAAAAGTGGCCTCAAATCAGAACCTCCACCCAACTATCAAATCCCAAAAATGGACGGCGACAAAAGAAACGCTACAACACACTCGCCGGTAGCCGAAGTGGTGGTGGTGATGGTGCCCTTCATAGCTCATGGCCATCTCAACCAGCTCCTACACCTCTCCCGCGTTATATCCAATTACAACATCCCCGTCCACTACATAAGCTTCACCACTCA...

Protein

Download Protein FASTA

505 aa · TkA04G062140|TK1151|PROTEIN

ARRKKHIIGSLTISKVKSGLKSEPPPNYQIPKMDGDKRNATTHSPVAEVVVVMVPFIAHGHLNQLLHLSRVISNYNIPVHYISFTTHIRQVRSRLHNSGPNSAASNLNIHFHEFPTPTFTSPDPNPSNRFPAHLQSAVESTLHLRRPVADLVLSLCSSTRRVAVIHDFLMSYVVQDVKSIPNAETYIFRPLSAFQTFWVTWEKSSRPFPMDPGLLKRLPSADGSSTPEFKSFVKLQVPHVDFQVGELFDSSRAIEGEYLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G062140
TK1151 IDTkA04G062140
OH-1004 IDLXL04_036235
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.800
Protein coverage (%)TK1151 93.663 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G062140
LocationChr04:16565343-16575675 (+)
DescriptionSimilar to ZOG1: Zeatin O-glucosyltransferase
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036235 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009101 glycoprotein biosynthetic process Biological Process
GO:0009690 cytokinin metabolic process Biological Process
GO:0009965 leaf morphogenesis Biological Process
GO:0010015 root morphogenesis Biological Process
GO:0010083 regulation of vegetative meristem growth Biological Process
GO:0010380 regulation of chlorophyll biosynthetic process Biological Process
GO:0010817 regulation of hormone levels Biological Process
GO:0045926 negative regulation of growth Biological Process
GO:0048316 seed development Biological Process
GO:0048439 flower morphogenesis Biological Process
GO:0080036 regulation of cytokinin-activated signaling pathway Biological Process
GO:0035251 UDP-glucosyltransferase activity Molecular Function
KEGG gene cross-reference
ag:AAD04166
zma:541881
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.739
Rank 1 · TkA04G062140 · TK1151
Nucleus0.320
Rank 2 · TkA04G062140 · TK1151
Endoplasmic reticulum0.073
Rank 3 · TkA04G062140 · TK1151
Plastid0.062
Rank 4 · TkA04G062140 · TK1151
Cell membrane0.052
Rank 5 · TkA04G062140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N48-280 aa
PF00201UDPGT296-425 aa
PF09061Stirrup438-474 aa
PF26168Glyco_transf_N468-494 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G062140PF26168Glyco_transf_N482801.9e-67228.3
TkA04G062140PF00201UDPGT2964258.6e-2175.0
TkA04G062140PF09061Stirrup4384740.06514.2
TkA04G062140PF26168Glyco_transf_N4684941.9e-67228.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser