TkA04G040250 | RubberDandelionOmics

Gene overview

TkA04G040250

Reference: TK1151 Chr: Chr04 Coordinates: 10766576-10767194 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

447 bp · TkA04G040250|TK1151|cDNA

ATGGAAACCGGAGGAGAAATCCTTAACTTGGACGAGTACATAAGGTCTTTTCCTCCAATCCTTGGCACAAAACCACTCGGATTCGTTTCAGAGGGGTCGAGAGCGACTGGCGTGGTGTCTCTCAGAAGCGCAGACCTCGTGCAGGCCTTGCTCGATGCAAATCGATGGAGAGATATGTTTTCCAGCATGATCAAAAGCAGTGCTACAACGGAAGTCATTCTCGATGACGGCAAAAACAATGCCCTCCAACTTATGCAAGC...

CDS

Download CDS FASTA

447 bp · TkA04G040250|TK1151|CDS

ATGGAAACCGGAGGAGAAATCCTTAACTTGGACGAGTACATAAGGTCTTTTCCTCCAATCCTTGGCACAAAACCACTCGGATTCGTTTCAGAGGGGTCGAGAGCGACTGGCGTGGTGTCTCTCAGAAGCGCAGACCTCGTGCAGGCCTTGCTCGATGCAAATCGATGGAGAGATATGTTTTCCAGCATGATCAAAAGCAGTGCTACAACGGAAGTCATTCTCGATGACGGCAAAAACAATGCCCTCCAACTTATGCAAGC...

Protein

Download Protein FASTA

148 aa · TkA04G040250|TK1151|PROTEIN

METGGEILNLDEYIRSFPPILGTKPLGFVSEGSRATGVVSLRSADLVQALLDANRWRDMFSSMIKSSATTEVILDDGKNNALQLMQAEIQLISPSVPARVMKFFRFSRQQAEGVWAVVDLSFDVDDNGGMCRRLPSGCILYQLFFIAF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G040250`
TK1151 ID	TkA04G040250
OH-1004 ID	LXL04_008231
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	70.700
Protein coverage (%)	TK1151 96.622 / OH-1004 20.822 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G040250

Location Chr04:10766576-10767194 (-)

Description Similar to HDG1: Homeobox-leucine zipper protein HDG1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61150`	Probable transcription factor (By similarity).	CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis.2011 · DOI: 10.1105/tpc.111.088625 Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12211
`At4g00730`	Probable transcription factor involved in the regulation of the tissue-specific accumulation of anthocyanins and in cellular organization of the primary root.	ANTHOCYANINLESS2, a homeobox gene affecting anthocyanin distribution and root development in Arabidopsis.1999 · DOI: 10.1105/tpc.11.7.1217
`At4g21750`	Probable transcription factor involved in cell specification and pattern formation during embryogenesis.	Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein.2001 · DOI: 10.1046/j.1365-313x.2001.01047.x Regulation of shoot epidermal cell differentiation by a pair of homeodomain proteins in Arabidopsis.2003 · DOI: 10.1242/dev.00292 Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element.2014 · DOI: 10.1105/tpc.114.127647

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0569100`	Probable transcription factor.	No verified direct reference in this release
`Os09g0526300`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008231 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0009845 seed germination Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0030154 cell differentiation Biological Process

GO:0043481 anthocyanin accumulation in tissues in response to UV light Biological Process

GO:0048364 root development Biological Process

GO:0048497 maintenance of floral organ identity Biological Process

GO:0048765 root hair cell differentiation Biological Process

GO:0048825 cotyledon development Biological Process

GO:0090627 plant epidermal cell differentiation Biological Process

KEGG gene cross-reference

ath:AT3G61150

ath:AT4G00730

ath:AT4G04890

dosa:Os02g0674800

dosa:Os04g0569100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.342

Rank 1 · TkA04G040250 · TK1151

Nucleus0.323

Rank 2 · TkA04G040250 · TK1151

Cell membrane0.171

Rank 3 · TkA04G040250 · TK1151

Endoplasmic reticulum0.129

Rank 4 · TkA04G040250 · TK1151

Plastid0.090

Rank 5 · TkA04G040250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01852START10-140 aa

PF15002ERK-JNK_inhib37-92 aa

PF06141Phage_tail_U38-124 aa

PF18517LZ3wCH52-65 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G040250	`PF01852`	START	10	140	4.5e-15	56.3
TkA04G040250	`PF15002`	ERK-JNK_inhib	37	92	0.0013	19.1
TkA04G040250	`PF06141`	Phage_tail_U	38	124	0.17	12.8
TkA04G040250	`PF18517`	LZ3wCH	52	65	0.19	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2E8`	Arabidopsis thaliana	sp\|Q9M2E8\|HDG1_ARATH Homeobox-leucine zipper protein HDG1	48.600%	Swiss-Prot	Medium
`Q0WV12`	Arabidopsis thaliana	sp\|Q0WV12\|ANL2_ARATH Homeobox-leucine zipper protein ANTHOCYANINLESS 2	48.300%	Swiss-Prot	Medium
`Q8RWU4`	Arabidopsis thaliana	sp\|Q8RWU4\|ATML1_ARATH Homeobox-leucine zipper protein MERISTEM L1	41.300%	Swiss-Prot	Medium
`Q7Y0V9`	Oryza sativa subsp. japonica	sp\|Q7Y0V9\|ROC4_ORYSJ Homeobox-leucine zipper protein ROC4	49.000%	Swiss-Prot	Medium
`Q7Y0V7`	Oryza sativa subsp. japonica	sp\|Q7Y0V7\|ROC6_ORYSJ Homeobox-leucine zipper protein ROC6	41.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card