RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G033570
Reference: TK1151 Chr: Chr04 Coordinates: 8995277-8997853 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2033 bp · TkA04G033570|TK1151|cDNA

TACTTCCTCTTTAACCCCTCCCCCAATCCCGCCTCTCAAAATCGTCTATAATGACTTCCCCAGCTACCACGAGTACCATTTAAACCGGCCACCCCCCACCACCTCCTCTCCTTTGTCTTCTCTAATTCTTTCATGTCTTCTTTTTCCGATCAAGCTCCACCTCCCCGGACCGGCGGACTCGCTGCTCGAATCTCAGAAAGAGTGGGCTCCGGTGTACCAAAATTCAAGTCAATCCCTCCACCTTCACTACCCATCTCCCC...

CDS

Download CDS FASTA

1563 bp · TkA04G033570|TK1151|CDS

ATGTCTTCTTTTTCCGATCAAGCTCCACCTCCCCGGACCGGCGGACTCGCTGCTCGAATCTCAGAAAGAGTGGGCTCCGGTGTACCAAAATTCAAGTCAATCCCTCCACCTTCACTACCCATCTCCCCGCCGGCAATCTCGCCTTCTTCCTACTTCTCTATTCCCGCTGGTCTAAGCCCAGCTGATCTTTTGGATTCCCCTGTTCTTCTCTCGTCTTCCCATATTCTGCCATCTCCGACTACTGGTTCCTTCCCATTTCA...

Protein

Download Protein FASTA

520 aa · TkA04G033570|TK1151|PROTEIN

MSSFSDQAPPPRTGGLAARISERVGSGVPKFKSIPPPSLPISPPAISPSSYFSIPAGLSPADLLDSPVLLSSSHILPSPTTGSFPFHAFNWKNLSSNIQNHEQSIKKEQKSFTDFSFQQQLNHPTEQLWNQQKQSEHPSQFQSFSPEISTIQTDSNSQTQSFQSGYAASNNNQLSQKKSDDGYNWRKYGQKQVKGSENPRSYYKCTYPNCSMKKKLETNSDGQITEIVYKGSHNHPKPQSTRRSSASNQLQMAQVSNNHE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G033570
TK1151 IDTkA04G033570
OH-1004 IDLXL04_036619
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 85.106
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G033570
LocationChr04:8995277-8997853 (+)
DescriptionSimilar to WRKY24: WRKY transcription factor WRKY24
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g38470 Transcription factor.
Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses.2009 · DOI: 10.1007/s11103-008-9408-3
Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance.2011 · DOI: 10.1007/s00425-011-1375-2
Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis.2011 · DOI: 10.1105/tpc.111.084996
Arabidopsis sigma factor binding proteins are activators of the WRKY33 transcription factor in plant defense.2011 · DOI: 10.1105/tpc.111.090571
Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection.2012 · DOI: 10.1104/pp.111.192641
At5g07100 Transcription factor.
Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance.2011 · DOI: 10.1007/s00425-011-1375-2

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: Q6B6R4 Transcription repressor (By similarity). No verified direct reference in this release
Os01g0826400 May participate in transcriptional regulation of abscisic acid and gibberellin signaling.
Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312
A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036619 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0006970 response to osmotic stress Biological Process
GO:0009408 response to heat Biological Process
GO:0009409 response to cold Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009627 systemic acquired resistance Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009739 response to gibberellin Biological Process
GO:0009740 gibberellic acid mediated signaling pathway Biological Process
KEGG gene cross-reference
ath:AT2G38470
ath:AT5G07100
dosa:Os01g0826400
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.953
Rank 1 · TkA04G033570 · TK1151
Cytoplasm0.194
Rank 2 · TkA04G033570 · TK1151
Mitochondrion0.016
Rank 3 · TkA04G033570 · TK1151
Cell membrane0.013
Rank 4 · TkA04G033570 · TK1151
Lysosome / Vacuole0.007
Rank 5 · TkA04G033570 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12595iRhom1-2_N36-59 aa
PF03106WRKY180-236 aa
PF04500FLYWCH194-235 aa
PF04606Ogr_Delta200-213 aa
PF23549Zn_ribbon_GRF_2200-211 aa
PF03106WRKY351-408 aa
PF04500FLYWCH352-407 aa
PF23549Zn_ribbon_GRF_2368-378 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G033570PF12595iRhom1-2_N36590.05413.8
TkA04G033570PF03106WRKY1802361.4e-51173.2
TkA04G033570PF04500FLYWCH1942350.4911.3
TkA04G033570PF04606Ogr_Delta2002130.4211.3
TkA04G033570PF23549Zn_ribbon_GRF_22002110.5610.8
TkA04G033570PF03106WRKY3514081.4e-51173.2
TkA04G033570PF04500FLYWCH3524070.4911.3
TkA04G033570PF23549Zn_ribbon_GRF_23683780.5610.8
TkA04G033570PF04606Ogr_Delta3723830.4211.3
TkA04G033570PF12595iRhom1-2_N3884440.05413.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8S8P5Arabidopsis thalianasp|Q8S8P5|WRK33_ARATH Probable WRKY transcription factor 3341.700%Swiss-ProtMedium
Q9C5T3Arabidopsis thalianasp|Q9C5T3|WRK26_ARATH Probable WRKY transcription factor 2644.700%Swiss-ProtMedium
Q6B6R4Oryza sativa subsp. indicasp|Q6B6R4|WRK24_ORYSI WRKY transcription factor WRKY2444.700%Swiss-ProtMedium
Q6IEQ7Oryza sativa subsp. japonicasp|Q6IEQ7|WRK24_ORYSJ WRKY transcription factor WRKY2444.500%Swiss-ProtMedium

JBrowse

View in Genome Browser