TkA04G033110 | RubberDandelionOmics

Gene overview

TkA04G033110

Reference: TK1151 Chr: Chr04 Coordinates: 8863823-8871735 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2326 bp · TkA04G033110|TK1151|cDNA

ACACAAAATAAAAGCAAAACCTTCGGGTGGCGTTTGGTTGACACGAAAGGAAAGAAATTGGAAGAAAAACCAATTCCTGTGTTTGGTTTGTATCAGCAAATGGAAAAGGATCCTTAAATGAATAAATTTTTTCTCAAAGTCTGGATTGTTGTTTCCATGGAAGGGATGATTGAATTAATTCATTTGGAGGAAGGAAACTGCCAAAAGACCGTAATGCCCTCAATTAACAAAACCCTACACTTCCATCGGCCGACATTTCT...

CDS

Download CDS FASTA

1734 bp · TkA04G033110|TK1151|CDS

ATGACGGATACGCAGGTAGTTAAACGTGCCAAGTACAAGTCTTCCGTCAAAGACCCTGGCGTTCTTGGGGAATTGAAAATGACCAGGGAGAGGTTTGTTTTTACGCCCTATGATGGATCGTCCATGAAGCTTAATGTAGAATTCAGACTTATAAAAGGACACAAATCCAGCAAGGAGGGTAACAAGCGACCTGCCTTACTCAATCTCACTCAAGATCAGGGTAATTATATCTTCGAGTTTGACAATTTCTCAGACAGGGA...

Protein

Download Protein FASTA

577 aa · TkA04G033110|TK1151|PROTEIN

MTDTQVVKRAKYKSSVKDPGVLGELKMTRERFVFTPYDGSSMKLNVEFRLIKGHKSSKEGNKRPALLNLTQDQGNYIFEFDNFSDREVCRDFVAKCMTFYGSENEQLSSAEMDRRIKLLQENSELQKLHKQFVMGSVLSETEFWATRKKLLDVKDSRKAKQRVGLKSDMIFNVKPSSDGQSNRVTFNLTPEMIHQIFAEKPAVRQAYLSFVPNKMTEKDFWTKYWRAQYLHSTRNIVAAAAEAAEDEELAVFLKQDPILA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G033110`
TK1151 ID	TkA04G033110
OH-1004 ID	LXL04_031064
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.100
Protein coverage (%)	TK1151 98.094 / OH-1004 99.648 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G033110

Location Chr04:8863823-8871735 (-)

Description Similar to TFB1-1: General transcription and DNA repair factor IIH subunit TFB1-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55750`	Component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II.	No verified direct reference in this release
`At3g61420`	Component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031064 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000079 regulation of cyclin-dependent protein serine/threonine kinase activity Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006360 transcription by RNA polymerase I Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006367 transcription initiation at RNA polymerase II promoter Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:1990830 cellular response to leukemia inhibitory factor Biological Process

GO:0000112 nucleotide-excision repair factor 3 complex Cellular Component

GO:0000439 transcription factor TFIIH core complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G55750

ath:AT3G61420

ddi:DDB_G0268014

hsa:2965

mmu:14884

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.706

Rank 1 · TkA04G033110 · TK1151

Cytoplasm0.308

Rank 2 · TkA04G033110 · TK1151

Cell membrane0.031

Rank 3 · TkA04G033110 · TK1151

Golgi apparatus0.024

Rank 4 · TkA04G033110 · TK1151

Endoplasmic reticulum0.021

Rank 5 · TkA04G033110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08567PH_TFIIH23-91 aa

PF11398DUF281369-131 aa

PF03909BSD118-156 aa

PF26672DUF1631_3rd152-196 aa

PF08567PH_TFIIH175-188 aa

PF03909BSD183-234 aa

PF26672DUF1631_3rd228-270 aa

PF18859acVLRF1238-261 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G033110	`PF08567`	PH_TFIIH	23	91	9.3e-05	23.4
TkA04G033110	`PF11398`	DUF2813	69	131	0.058	13.5
TkA04G033110	`PF03909`	BSD	118	156	1.5e-13	51.2
TkA04G033110	`PF26672`	DUF1631_3rd	152	196	0.2	12.5
TkA04G033110	`PF08567`	PH_TFIIH	175	188	9.3e-05	23.4
TkA04G033110	`PF03909`	BSD	183	234	1.5e-13	51.2
TkA04G033110	`PF26672`	DUF1631_3rd	228	270	0.2	12.5
TkA04G033110	`PF18859`	acVLRF1	238	261	1.2	10.1
TkA04G033110	`PF18859`	acVLRF1	313	375	1.2	10.1
TkA04G033110	`PF11398`	DUF2813	431	563	0.058	13.5
TkA04G033110	`PF26672`	DUF1631_3rd	486	561	0.2	12.5
TkA04G033110	`PF03909`	BSD	492	497	1.5e-13	51.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3ECP0`	Arabidopsis thaliana	sp\|Q3ECP0\|TFB1A_ARATH General transcription and DNA repair factor IIH subunit TFB1-1	58.400%	Swiss-Prot	High
`Q9M322`	Arabidopsis thaliana	sp\|Q9M322\|TFB1C_ARATH General transcription and DNA repair factor IIH subunit TFB1-3	58.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card