TkA04G032640 | RubberDandelionOmics

Gene overview

TkA04G032640

Reference: TK1151 Chr: Chr04 Coordinates: 8712683-8720495 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1521 bp · TkA04G032640|TK1151|cDNA

ATGCAGAAAATAGCGTCAGTGAGCTTTCACGATAATATCAATTCGATTTACTGGAGCGGGTGGTCAGAGAACACAAAAGCTATAGTCTATACCTTTTACCCAATAGGAAGTCTCAAAAATGTGCTACACGGAAACGCGATTTCTGGGAGGAGATCATATACACTAAATATGAAAACAAGAATCTGGATAGCCCTCCAAGTTGCTACAACTCTCGACTACATACACAAACAGGGGTTAGTCCACGGAAATTTGAAGTCGTC...

CDS

Download CDS FASTA

1521 bp · TkA04G032640|TK1151|CDS

ATGCAGAAAATAGCGTCAGTGAGCTTTCACGATAATATCAATTCGATTTACTGGAGCGGGTGGTCAGAGAACACAAAAGCTATAGTCTATACCTTTTACCCAATAGGAAGTCTCAAAAATGTGCTACACGGAAACGCGATTTCTGGGAGGAGATCATATACACTAAATATGAAAACAAGAATCTGGATAGCCCTCCAAGTTGCTACAACTCTCGACTACATACACAAACAGGGGTTAGTCCACGGAAATTTGAAGTCGTC...

Protein

Download Protein FASTA

506 aa · TkA04G032640|TK1151|PROTEIN

MQKIASVSFHDNINSIYWSGWSENTKAIVYTFYPIGSLKNVLHGNAISGRRSYTLNMKTRIWIALQVATTLDYIHKQGLVHGNLKSSNIFIKETGTWKIAVAEIGLVFLTSKELGGGVTWIQSSVEEQPPKQPSATTIVAQPSSITAIEFWCEKGLRPAPLSGFYRCQGGPATGAAFFSVRCCCRRKNRHSSALLEETGDSWTTKNRHLDIPRSYELVRLCFRPPPPPPAAMSLVAVGGDDYDVVRIVDVTFSEHPTACR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G032640`
TK1151 ID	TkA04G032640
OH-1004 ID	LXL04_015782
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	45.100
Protein coverage (%)	TK1151 20.158 / OH-1004 48.476 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G032640

Location Chr04:8712683-8720495 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23740`	Probable inactive receptor kinase At4g23740.	No verified direct reference in this release
`At5g53320`	Probable inactive receptor kinase At5g53320.	No verified direct reference in this release
`At1g64210`	Putative inactive receptor-like protein kinase At1g64210.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015782 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.551

Rank 1 · TkA04G032640 · TK1151

Nucleus0.391

Rank 2 · TkA04G032640 · TK1151

Cell membrane0.102

Rank 3 · TkA04G032640 · TK1151

Mitochondrion0.072

Rank 4 · TkA04G032640 · TK1151

Endoplasmic reticulum0.055

Rank 5 · TkA04G032640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase5-100 aa

PF07714PK_Tyr_Ser-Thr9-100 aa

PF14531Kinase-like52-98 aa

PF01923Cob_adeno_trans132-198 aa

PF16907Caskin-Pro-rich223-235 aa

PF09645F-112241-285 aa

PF01923Cob_adeno_trans286-351 aa

PF16907Caskin-Pro-rich376-388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G032640	`PF00069`	Pkinase	5	100	3.1e-09	37.3
TkA04G032640	`PF07714`	PK_Tyr_Ser-Thr	9	100	3.6e-11	43.6
TkA04G032640	`PF14531`	Kinase-like	52	98	0.031	14.3
TkA04G032640	`PF01923`	Cob_adeno_trans	132	198	5.9e-05	23.8
TkA04G032640	`PF16907`	Caskin-Pro-rich	223	235	0.05	14.8
TkA04G032640	`PF09645`	F-112	241	285	0.17	12.7
TkA04G032640	`PF01923`	Cob_adeno_trans	286	351	5.9e-05	23.8
TkA04G032640	`PF16907`	Caskin-Pro-rich	376	388	0.05	14.8
TkA04G032640	`PF09645`	F-112	394	442	0.17	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUQ3`	Arabidopsis thaliana	sp\|Q9SUQ3\|Y4374_ARATH Probable inactive receptor kinase At4g23740	35.200%	Swiss-Prot	Low
`Q9FK10`	Arabidopsis thaliana	sp\|Q9FK10\|Y5332_ARATH Probable inactive receptor kinase At5g53320	35.700%	Swiss-Prot	Low
`Q9SH71`	Arabidopsis thaliana	sp\|Q9SH71\|Y1421_ARATH Putative inactive receptor-like protein kinase At1g64210	37.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card