TkA04G030310 | RubberDandelionOmics

Gene overview

TkA04G030310

Reference: TK1151 Chr: Chr04 Coordinates: 8015419-8017581 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1230 bp · TkA04G030310|TK1151|cDNA

TTCAAACTTGCAAACAGTCTCCGACTCTCTGTGTATTCCTTTTTTACACGAATTGCTTCACGAATTGCTTAACAGATTGAGTCGATTTCTGACTCTGTAGTCTTCCAGCATAACAACAAACGATTTGATGGCCAATGAGATCACATCCAACAGTTATGAAGAGGCTCGAAAGCAACAGCTACTTGAGAACAAAAAAAGATTTGAGGAACTAGGAATCTTGAGTATTACTAAAAGCCTAACTGATCTTTCAAAATCTGAAA...

CDS

Download CDS FASTA

915 bp · TkA04G030310|TK1151|CDS

ATGGCCAATGAGATCACATCCAACAGTTATGAAGAGGCTCGAAAGCAACAGCTACTTGAGAACAAAAAAAGATTTGAGGAACTAGGAATCTTGAGTATTACTAAAAGCCTAACTGATCTTTCAAAATCTGAAAAGAAGTCAAAGCCACATGAAGTGAAACTAAAAATAAGAAATACTCCAATCACAGAACCAAGGCGTTCAACACGTGAACGAAACCCCATTGTTTCATATCATGATGAAGTGGATATAGGTCTTCCAAA...

Protein

Download Protein FASTA

304 aa · TkA04G030310|TK1151|PROTEIN

MANEITSNSYEEARKQQLLENKKRFEELGILSITKSLTDLSKSEKKSKPHEVKLKIRNTPITEPRRSTRERNPIVSYHDEVDIGLPNVRRRSKSNSSWTSYLARPLEEVKIAKYEERVEAMKSAEKLQTNLQSEFPSFVKSMVRSHVYSCFWLGLPMSFCKKHLPKSTVNMVLEDEDGNEYECVFISERTGISGGWRAFALEHKLDDGDALVFELIEPKRFKIHVVKASGDGILDDDDGDDDDDDDDDDGVIKKGSRGRP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G030310`
TK1151 ID	TkA04G030310
OH-1004 ID	LXL04_036658
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.300
Protein coverage (%)	TK1151 99.013 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G030310

Location Chr04:8015419-8017581 (+)

Description Similar to At5g58280: Putative B3 domain-containing protein At5g58280

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58280`	Putative B3 domain-containing protein At5g58280.	No verified direct reference in this release
`At3g19184`	B3 domain-containing protein At3g19184.	No verified direct reference in this release
`At5g42700`	B3 domain-containing protein At5g42700.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0481400`	B3 domain-containing protein Os05g0481400.	No verified direct reference in this release
`Os03g0184500`	B3 domain-containing protein Os03g0184500.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036658 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G19184

ath:AT5G58280

dosa:Os03g0184500

dosa:Os05g0481400

dosa:Os06g0194400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA04G030310 · TK1151

Cytoplasm0.073

Rank 2 · TkA04G030310 · TK1151

Cell membrane0.017

Rank 3 · TkA04G030310 · TK1151

Endoplasmic reticulum0.011

Rank 4 · TkA04G030310 · TK1151

Plastid0.007

Rank 5 · TkA04G030310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26705AFDN16-33 aa

PF05045RgpF123-157 aa

PF02362B3138-225 aa

PF14812PBP1_TM235-264 aa

PF26705AFDN236-287 aa

PF02362B3264-287 aa

PF14812PBP1_TM274-284 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G030310	`PF26705`	AFDN	16	33	5.8	7.9
TkA04G030310	`PF05045`	RgpF	123	157	0.083	12.3
TkA04G030310	`PF02362`	B3	138	225	1.2e-18	67.6
TkA04G030310	`PF14812`	PBP1_TM	235	264	0.0069	17.4
TkA04G030310	`PF26705`	AFDN	236	287	5.8	7.9
TkA04G030310	`PF02362`	B3	264	287	1.2e-18	67.6
TkA04G030310	`PF14812`	PBP1_TM	274	284	0.0069	17.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FHB2`	Arabidopsis thaliana	sp\|Q9FHB2\|Y5828_ARATH Putative B3 domain-containing protein At5g58280	52.000%	Swiss-Prot	High
`Q1G3M3`	Arabidopsis thaliana	sp\|Q1G3M3\|Y3918_ARATH B3 domain-containing protein At3g19184	40.400%	Swiss-Prot	Medium
`Q9FMZ4`	Arabidopsis thaliana	sp\|Q9FMZ4\|Y5270_ARATH B3 domain-containing protein At5g42700	35.900%	Swiss-Prot	Medium
`Q5KQI4`	Oryza sativa subsp. japonica	sp\|Q5KQI4\|Y5814_ORYSJ B3 domain-containing protein Os05g0481400	48.700%	Swiss-Prot	Medium
`Q10QS9`	Oryza sativa subsp. japonica	sp\|Q10QS9\|Y3845_ORYSJ B3 domain-containing protein Os03g0184500	37.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card