TkA04G028810 | RubberDandelionOmics

Gene overview

TkA04G028810

Reference: TK1151 Chr: Chr04 Coordinates: 7596369-7597463 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1006 bp · TkA04G028810|TK1151|cDNA

ATGGTGAATCACAGGTTATTTCCATTCCTGATATTAACGTTTCTTAGCTTTCAAAGCCTTTTAACAGCACATGAAGATCCATCTTACAAGGACATAAAAGTGGGAGTGATTCTTGACATGGAATCAGGGGTAGGGATGGTCATTTATCAATGCATCAACATGGCTATATCTGACTTTTATACAGCTAATCCACACTATAATACTAGGATAGTTTTTATCACAAGGGATACCAAAGGAGAACCACCACGTGCCTTGTCTGC...

CDS

Download CDS FASTA

1005 bp · TkA04G028810|TK1151|CDS

ATGGTGAATCACAGGTTATTTCCATTCCTGATATTAACGTTTCTTAGCTTTCAAAGCCTTTTAACAGCACATGAAGATCCATCTTACAAGGACATAAAAGTGGGAGTGATTCTTGACATGGAATCAGGGGTAGGGATGGTCATTTATCAATGCATCAACATGGCTATATCTGACTTTTATACAGCTAATCCACACTATAATACTAGGATAGTTTTTATCACAAGGGATACCAAAGGAGAACCACCACGTGCCTTGTCTGC...

Protein

Download Protein FASTA

335 aa · TkA04G028810|TK1151|PROTEIN

MVNHRLFPFLILTFLSFQSLLTAHEDPSYKDIKVGVILDMESGVGMVIYQCINMAISDFYTANPHYNTRIVFITRDTKGEPPRALSAVRDLLENTEVQAIIGPESTIEARFLEGLTENANKPILSFSTSPFSNRNPYIVGIAQDETTQFKGIASMVELFKATNVIVIGEDTKNGREMATYMVDVLQEKSVHVTGIILISTFANNEQVSEELHKLQTMQAMVFVVHTSPSLASKVFLRAKDLGMMDEGYTWISTSKNMNLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G028810`
TK1151 ID	TkA04G028810
OH-1004 ID	LXL04_036698
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.806 / OH-1004 21.341 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G028810

Location Chr04:7596369-7597463 (-)

Description Similar to GLR1.3: Glutamate receptor 1.3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29120`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At2g24720`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At2g29110`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At5g48400`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release
`At2g24710`	Glutamate-gated receptor that probably acts as a non-selective cation channel.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036698 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006874 intracellular calcium ion homeostasis Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030003 intracellular monoatomic cation homeostasis Biological Process

GO:0071230 cellular response to amino acid stimulus Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0005261 monoatomic cation channel activity Molecular Function

GO:0005262 calcium channel activity Molecular Function

GO:0008066 glutamate receptor activity Molecular Function

GO:0015276 ligand-gated monoatomic ion channel activity Molecular Function

GO:0038023 signaling receptor activity Molecular Function

KEGG gene cross-reference

ath:AT3G07520

ath:AT5G48400

ath:AT5G48410

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.582

Rank 1 · TkA04G028810 · TK1151

Extracellular0.152

Rank 2 · TkA04G028810 · TK1151

Cytoplasm0.096

Rank 3 · TkA04G028810 · TK1151

Endoplasmic reticulum0.087

Rank 4 · TkA04G028810 · TK1151

Lysosome / Vacuole0.037

Rank 5 · TkA04G028810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13458Peripla_BP_632-333 aa

PF13433Peripla_BP_545-102 aa

PF01094ANF_receptor49-333 aa

PF02878PGM_PMM_I55-100 aa

PF02878PGM_PMM_I152-200 aa

PF13433Peripla_BP_5162-332 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G028810	`PF13458`	Peripla_BP_6	32	333	5.4e-27	96.1
TkA04G028810	`PF13433`	Peripla_BP_5	45	102	0.044	13.6
TkA04G028810	`PF01094`	ANF_receptor	49	333	7.3e-52	177.3
TkA04G028810	`PF02878`	PGM_PMM_I	55	100	0.15	12.4
TkA04G028810	`PF02878`	PGM_PMM_I	152	200	0.15	12.4
TkA04G028810	`PF13433`	Peripla_BP_5	162	332	0.044	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LGN0`	Arabidopsis thaliana	sp\|Q8LGN0\|GLR27_ARATH Glutamate receptor 2.7	38.500%	Swiss-Prot	Medium
`Q9SHV1`	Arabidopsis thaliana	sp\|Q9SHV1\|GLR22_ARATH Glutamate receptor 2.2	34.600%	Swiss-Prot	Medium
`Q9C5V5`	Arabidopsis thaliana	sp\|Q9C5V5\|GLR28_ARATH Glutamate receptor 2.8	36.500%	Swiss-Prot	Medium
`Q9LV72`	Arabidopsis thaliana	sp\|Q9LV72\|GLR12_ARATH Glutamate receptor 1.2	35.600%	Swiss-Prot	Medium
`Q9SHV2`	Arabidopsis thaliana	sp\|Q9SHV2\|GLR23_ARATH Glutamate receptor 2.3	35.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card