TkA04G026900 | RubberDandelionOmics

Gene overview

TkA04G026900

Reference: TK1151 Chr: Chr04 Coordinates: 7077151-7081513 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

825 bp · TkA04G026900|TK1151|cDNA

ATGCATAACCATCAACCGGCATTATTTTTGGAAGGTCATCCTTATCCAAGAAGATTGACTGAAGATGAAACTCGGCTAGTGGAAGATTTGTTGGAAAAAAATGTTAAACCAAAAGATATAGTGTCCACTCTTAAAAAACAAAATGTAAATAATTTATCTACAATCAAAACTATCTACAATGCAGACGAAAAGATTCGACGTACGAAGAGGGGCGATAAAAGTCAAATGCAAGTTGTTATGGAATTTCTCGAACATAATGA...

CDS

Download CDS FASTA

825 bp · TkA04G026900|TK1151|CDS

ATGCATAACCATCAACCGGCATTATTTTTGGAAGGTCATCCTTATCCAAGAAGATTGACTGAAGATGAAACTCGGCTAGTGGAAGATTTGTTGGAAAAAAATGTTAAACCAAAAGATATAGTGTCCACTCTTAAAAAACAAAATGTAAATAATTTATCTACAATCAAAACTATCTACAATGCAGACGAAAAGATTCGACGTACGAAGAGGGGCGATAAAAGTCAAATGCAAGTTGTTATGGAATTTCTCGAACATAATGA...

Protein

Download Protein FASTA

274 aa · TkA04G026900|TK1151|PROTEIN

MHNHQPALFLEGHPYPRRLTEDETRLVEDLLEKNVKPKDIVSTLKKQNVNNLSTIKTIYNADEKIRRTKRGDKSQMQVVMEFLEHNDFVHESRANASTNELEDLFFAHPKSLEIWRAFPHVVLMDGTYNTNRYKLPLLEIVGEPDRHISCFNHGQPIYYSDPLMNKISIEFQPYVSDIVNVKGDGNCGFREDLNNLRDSLNFYGSSGAPRQYWLIMPPTGFLIAKKYGRTVHLISKHSSSTIFPLWHGPQDIPHHDFVVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G026900`
TK1151 ID	TkA04G026900
OH-1004 ID	LXL04_036736
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.000
Protein coverage (%)	TK1151 54.745 / OH-1004 47.188 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G026900`
Location	Chr04:7077151-7081513 (-)
Description	Similar to CHGG_01239: PKS-NRPS hybrid synthetase CHGG_01239 (Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036736` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006633 fatty acid biosynthetic process Biological Process GO:0007623 circadian rhythm Biological Process GO:0009403 toxin biosynthetic process Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0009639 response to red or far red light Biological Process GO:0010017 red or far-red light signaling pathway Biological Process GO:0010018 far-red light signaling pathway Biological Process GO:0010218 response to far red light Biological Process GO:0032259 methylation Biological Process GO:0042753 positive regulation of circadian rhythm Biological Process
KEGG gene cross-reference	ath:AT1G76320 ath:AT3G22170 ath:AT4G15090 ath:AT4G38180 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.650

Rank 1 · TkA04G026900 · TK1151

Cytoplasm0.365

Rank 2 · TkA04G026900 · TK1151

Extracellular0.042

Rank 3 · TkA04G026900 · TK1151

Endoplasmic reticulum0.030

Rank 4 · TkA04G026900 · TK1151

Mitochondrion0.021

Rank 5 · TkA04G026900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23159WHD_Rok34-71 aa

PF11123DNA_Packaging_270-104 aa

PF21056ZSWIM1-3_RNaseH-like82-141 aa

PF10551MULE121-145 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G026900	`PF23159`	WHD_Rok	34	71	0.24	12.1
TkA04G026900	`PF11123`	DNA_Packaging_2	70	104	0.22	12.4
TkA04G026900	`PF21056`	ZSWIM1-3_RNaseH-like	82	141	2.2e-06	28.3
TkA04G026900	`PF10551`	MULE	121	145	0.00047	21.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card