TkA04G025580 | RubberDandelionOmics

Gene overview

TkA04G025580

Reference: TK1151 Chr: Chr04 Coordinates: 6686047-6686770 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

652 bp · TkA04G025580|TK1151|cDNA

CCATAAACCACGAAATCCCCAAGGCAAACCTTGGAAAAGCTTAATTTTGTGGTGGTTAATCGGAAAAGCTCCCAAAATGGTCGAAGTGATCGGAGAGAACCATCCAGACAACACGTCGGAAGGGATTGAAGTTGGATTAAAAGCCATTGCCACGGCGGTGGACAAATCGCCTGACAATGGAGATGCAATTACCACCGTAACTGGCTCAAGTGGATCATTACAAGTCGGTGACCACGGTGGATCGTCGGAAAACAGCAGTC...

CDS

Download CDS FASTA

576 bp · TkA04G025580|TK1151|CDS

ATGGTCGAAGTGATCGGAGAGAACCATCCAGACAACACGTCGGAAGGGATTGAAGTTGGATTAAAAGCCATTGCCACGGCGGTGGACAAATCGCCTGACAATGGAGATGCAATTACCACCGTAACTGGCTCAAGTGGATCATTACAAGTCGGTGACCACGGTGGATCGTCGGAAAACAGCAGTCACTCCGACAAAAACGAAGATTCAGGATCAGGATCAGGATTGTCTAGCGACGACGATGGCATTTCAGATATTTTGAA...

Protein

Download Protein FASTA

192 aa · TkA04G025580|TK1151|PROTEIN

MVEVIGENHPDNTSEGIEVGLKAIATAVDKSPDNGDAITTVTGSSGSLQVGDHGGSSENSSHSDKNEDSGSGSGLSSDDDGISDILKFDGNTYKKDEPTTSHVDAGESSGASGKVVEEEIVELEFEKVKPKLATHSMHCPNCKAEVTKVVLRRKVITFRPAEPAVVPVEAPPRDPEDLVGCLSCLSLFTCSG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G025580`
TK1151 ID	TkA04G025580
OH-1004 ID	LXL04_036762
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 32.542 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G025580`
Location	Chr04:6686047-6686770 (-)
Description	Similar to MEBL: Membrane protein of ER body-like protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036762` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009753 response to jasmonic acid Biological Process GO:0010039 response to iron ion Biological Process GO:0030026 intracellular manganese ion homeostasis Biological Process GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0005773 vacuole Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009705 plant-type vacuole membrane Cellular Component GO:0010168 ER body Cellular Component GO:0016020 membrane Cellular Component
KEGG gene cross-reference	ath:AT4G27860 ath:AT4G27870 ath:AT5G24290 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.529

Rank 1 · TkA04G025580 · TK1151

Cytoplasm0.375

Rank 2 · TkA04G025580 · TK1151

Cell membrane0.176

Rank 3 · TkA04G025580 · TK1151

Endoplasmic reticulum0.095

Rank 4 · TkA04G025580 · TK1151

Golgi apparatus0.056

Rank 5 · TkA04G025580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09297Zn_ribbon_NUD127-146 aa

PF00403HMA135-154 aa

PF22811Zn_ribbon_NrdR137-150 aa

PF22811Zn_ribbon_NrdR181-189 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G025580	`PF09297`	Zn_ribbon_NUD	127	146	0.0093	16.4
TkA04G025580	`PF00403`	HMA	135	154	0.036	15.2
TkA04G025580	`PF22811`	Zn_ribbon_NrdR	137	150	0.16	12.6
TkA04G025580	`PF22811`	Zn_ribbon_NrdR	181	189	0.16	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card