TkA04G024960 | RubberDandelionOmics

Gene overview

TkA04G024960

Reference: TK1151 Chr: Chr04 Coordinates: 6498334-6499729 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1246 bp · TkA04G024960|TK1151|cDNA

GAAATTCAAGTGAGCGGTTTTCCCCTTAATAAAGCCCTCCATAACACTCGCTGAGTTGTCTCTCTTTCTCTCTCCAACGAACTCTGTGAAGAAATGAGAGGAAACTGAGACAAAAATCCCACAGAAAGTAACAAAAAGAAGCAAATCATCCAAAATACATATCCATTTCATCACCACACAATTCATTCTGTGTCCATCAGAAGCGTCATTTTCTCTTCGTTCGAGGTGGTTTTGGAATGGAATACACCGGTGGTGGCCGG...

CDS

Download CDS FASTA

819 bp · TkA04G024960|TK1151|CDS

ATGGAATACACCGGTGGTGGCCGGAGCCTGCGTTACGAGTTAGATGAAGAAACTAACGATGCACCTGCTACTACACCGGGTGGATTAACGCTCGGCGGAATCCTCTCGATCAAACAGACGCCGCCGTATCGCATCCAAGATCGGACTCTACTGGATCTTATACGTGACGATCAGACGTGTGGAAAGGAACCGAAGGCGACGTGGAAGATGTTTAGGGAGAAACTCCGGCTTAAACTCGCTGGCTCAGTCTGTACAACCAC...

Protein

Download Protein FASTA

272 aa · TkA04G024960|TK1151|PROTEIN

MEYTGGGRSLRYELDEETNDAPATTPGGLTLGGILSIKQTPPYRIQDRTLLDLIRDDQTCGKEPKATWKMFREKLRLKLAGSVCTTTAPTLASLIPITTESNRISTRIGSTQQNSTEESTQQLNSPQVRNSTNLPDTETETETARVQTHSPVEESEQNSTEENRSTGGNGGEPAGARMSLMSLLEVEGSAYLDYEEEQEVDEEEEVEEAGGGGGGGGGYKYNNCCVCMVRHKGAAFIPCGHTFCRLCSRELFVQRACCPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G024960`
TK1151 ID	TkA04G024960
OH-1004 ID	LXL04_008483
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	94.900
Protein coverage (%)	TK1151 28.676 / OH-1004 62.400 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G024960`
Location	Chr04:6498334-6499729 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_008483` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.529

Rank 1 · TkA04G024960 · TK1151

Nucleus0.393

Rank 2 · TkA04G024960 · TK1151

Cell membrane0.184

Rank 3 · TkA04G024960 · TK1151

Mitochondrion0.070

Rank 4 · TkA04G024960 · TK1151

Endoplasmic reticulum0.067

Rank 5 · TkA04G024960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29052PGA28-like_dom99-184 aa

PF13920zf-C3HC4_3222-265 aa

PF13639zf-RING_2222-262 aa

PF14634zf-RING_5222-262 aa

PF13923zf-C3HC4_2224-261 aa

PF00097zf-C3HC4224-261 aa

PF14447Prok-RING_4224-263 aa

PF24921RING_XB3-XBAT31224-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G024960	`PF29052`	PGA28-like_dom	99	184	1.5	9.2
TkA04G024960	`PF13920`	zf-C3HC4_3	222	265	1.3e-08	35.2
TkA04G024960	`PF13639`	zf-RING_2	222	262	0.00028	21.8
TkA04G024960	`PF14634`	zf-RING_5	222	262	0.0034	18.0
TkA04G024960	`PF13923`	zf-C3HC4_2	224	261	0.00071	20.1
TkA04G024960	`PF00097`	zf-C3HC4	224	261	0.0012	19.4
TkA04G024960	`PF14447`	Prok-RING_4	224	263	0.016	15.8
TkA04G024960	`PF24921`	RING_XB3-XBAT31	224	254	1.2	10.0
TkA04G024960	`PF13445`	zf-RING_UBOX	224	259	2.1	9.1
TkA04G024960	`PF15227`	zf-C3HC4_4	224	261	5.8	7.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card