TkA04G024730 | RubberDandelionOmics

Gene overview

TkA04G024730

Reference: TK1151 Chr: Chr04 Coordinates: 6420091-6422624 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1448 bp · TkA04G024730|TK1151|cDNA

TTTATGTGTGTGTATATACATATATGTATGTGTATATATATAGTTTATCATCCATACCAAACGTTGTTCATCAATAGAGAGTACATGATCAATTGAATCATGGAGTCATTAGGAGAAGATTACAATATGTCAACTGAAGAGGAAGGGATGCTGAAAATGATGGAGATAAATGGAGGAATAGTTCTTCCCATGGTCATTAAAACTGCAATAGAACTTGATCTCTTTGAGATCATGGCAAAGACTCCTAATGGTCAATTCTC...

CDS

Download CDS FASTA

1104 bp · TkA04G024730|TK1151|CDS

ATGGAGTCATTAGGAGAAGATTACAATATGTCAACTGAAGAGGAAGGGATGCTGAAAATGATGGAGATAAATGGAGGAATAGTTCTTCCCATGGTCATTAAAACTGCAATAGAACTTGATCTCTTTGAGATCATGGCAAAGACTCCTAATGGTCAATTCTCTTCTTTTGATCTTGCTTCTAGTCTTCCAAAACAAAACCCTCAAACCCCTGTTTTAATTGAACGAATCCTTCGGTATCTTGCTAGCCAATCCATTCTCTC...

Protein

Download Protein FASTA

367 aa · TkA04G024730|TK1151|PROTEIN

MESLGEDYNMSTEEEGMLKMMEINGGIVLPMVIKTAIELDLFEIMAKTPNGQFSSFDLASSLPKQNPQTPVLIERILRYLASQSILSSTLVRDESGNSKNVYGMTPLSNNYVRNKDGTSHASTVLLIYDKILVDCWYHLKDAIVEGGIPFNKAHGVNAFEYHAMDNRYNQVFNKSMYDNTTIVMKMILEKYKGFEGVKQLVDVGGGLGANLDTILSKYPNIKGINFDLPFVIKDAPSSLGVEHVGGDMFESVPKGDVIFM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G024730`
TK1151 ID	TkA04G024730
OH-1004 ID	LXL04_036780
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G024730`
Location	Chr04:6420091-6422624 (+)
Description	Similar to OMT1: Caffeic acid 3-O-methyltransferase 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036780` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009699 phenylpropanoid biosynthetic process Biological Process GO:0009809 lignin biosynthetic process Biological Process GO:0009813 flavonoid biosynthetic process Biological Process GO:0032259 methylation Biological Process GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function GO:0046983 protein dimerization activity Molecular Function GO:0047763 caffeate O-methyltransferase activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.867

Rank 1 · TkA04G024730 · TK1151

Nucleus0.294

Rank 2 · TkA04G024730 · TK1151

Endoplasmic reticulum0.048

Rank 3 · TkA04G024730 · TK1151

Mitochondrion0.034

Rank 4 · TkA04G024730 · TK1151

Cell membrane0.032

Rank 5 · TkA04G024730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08100Dimerisation22-113 aa

PF00891Methyltransf_2136-346 aa

PF21901TMEM87A-B_GOLD168-187 aa

PF05891Methyltransf_PK183-305 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G024730	`PF08100`	Dimerisation	22	113	2.7e-14	53.6
TkA04G024730	`PF00891`	Methyltransf_2	136	346	1.5e-65	221.2
TkA04G024730	`PF21901`	TMEM87A-B_GOLD	168	187	0.044	14.9
TkA04G024730	`PF05891`	Methyltransf_PK	183	305	0.015	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card