TkA04G020890 | RubberDandelionOmics

Gene overview

TkA04G020890

Reference: TK1151 Chr: Chr04 Coordinates: 5317142-5319361 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1959 bp · TkA04G020890|TK1151|cDNA

ATTTTACACGTGACAGTAAAATCAATTGAGAACCCATGACGAGCTGGGCTCGTGAAAATAGCCTATGGCCACTGTAAATATACAGTTTTTACTATTATATAATCAAAAATTGATGTGAGTGGTTGCCCAAAAACTCTCAATTCCAGTGGACTTTAGATCACGAGCGACAGTGGTCGCTCTTACCTCCGACAAAACCGCCTGCTTCTGCCGCCGCCCGCCTGACCTCATTTTTTGTTATCAGGTTTGTACTTTGTAGGGAT...

CDS

Download CDS FASTA

945 bp · TkA04G020890|TK1151|CDS

ATGGGGTCAAAAGTAGAAGATGTTGACGAGTTGATGCACAATATACAATCATTTTTGCCTTTAAAAGAAGCAGCCCGCACTTGCGTGTTATCCAAGTCTTGGCTGCGAGCGTGGTCTACCATCCCTACCCTCAATTTCAATGTTGGAAGAGGAAAGAAGCTGAAGTTGATGGACATGTCCCGCACTGTGATTCGGTATCTCCGAGACAACATCCCAATCGAAACGTTTACCCTTAAGATCGACATCGAGGACCAAGAGTC...

Protein

Download Protein FASTA

314 aa · TkA04G020890|TK1151|PROTEIN

MGSKVEDVDELMHNIQSFLPLKEAARTCVLSKSWLRAWSTIPTLNFNVGRGKKLKLMDMSRTVIRYLRDNIPIETFTLKIDIEDQESASHLSENLIGPMASKTCLKKISLQINLWCRLYMVSFMLPDEIWASENLTTISVSTPMKWDRSIWMATTPVIKCVSLRKLHLDGVCMSEEVLHDILSSCKLLEKISLIDCCKGFKTIKVENLYELKISLREVDEHGYFTSTRVETKYASYSIQRPFNTNQQLDEINIRWCDNGH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G020890`
TK1151 ID	TkA04G020890
OH-1004 ID	LXL04_036851
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	80.500
Protein coverage (%)	TK1151 72.611 / OH-1004 23.313 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G020890`
Location	Chr04:5317142-5319361 (+)
Description	Similar to At5g02700: Putative F-box/LRR-repeat protein At5g02700
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036851` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005739 mitochondrion Cellular Component
KEGG gene cross-reference	ath:AT1G58310 ath:AT3G28410 ath:AT5G02700 ath:AT5G02920 ath:AT5G56410 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.681

Rank 1 · TkA04G020890 · TK1151

Cytoplasm0.260

Rank 2 · TkA04G020890 · TK1151

Cell membrane0.085

Rank 3 · TkA04G020890 · TK1151

Endoplasmic reticulum0.064

Rank 4 · TkA04G020890 · TK1151

Mitochondrion0.030

Rank 5 · TkA04G020890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box9-40 aa

PF12937F-box-like9-37 aa

PF29594LRR_SKP239-65 aa

PF23622LRR_At1g61320_AtMIF164-93 aa

PF07723LRR_2104-112 aa

PF12937F-box-like109-119 aa

PF24758LRR_At5g56370113-206 aa

PF00646F-box125-130 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G020890	`PF00646`	F-box	9	40	1.5e-05	25.4
TkA04G020890	`PF12937`	F-box-like	9	37	4.8	7.7
TkA04G020890	`PF29594`	LRR_SKP2	39	65	0.063	13.2
TkA04G020890	`PF23622`	LRR_At1g61320_AtMIF1	64	93	0.0053	16.9
TkA04G020890	`PF07723`	LRR_2	104	112	0.017	16.5
TkA04G020890	`PF12937`	F-box-like	109	119	4.8	7.7
TkA04G020890	`PF24758`	LRR_At5g56370	113	206	2e-08	34.9
TkA04G020890	`PF00646`	F-box	125	130	1.5e-05	25.4
TkA04G020890	`PF12937`	F-box-like	125	129	4.8	7.7
TkA04G020890	`PF23622`	LRR_At1g61320_AtMIF1	154	209	0.0053	16.9
TkA04G020890	`PF29594`	LRR_SKP2	159	210	0.063	13.2
TkA04G020890	`PF07723`	LRR_2	162	185	0.017	16.5
TkA04G020890	`PF00646`	F-box	172	203	1.5e-05	25.4
TkA04G020890	`PF12937`	F-box-like	175	196	4.8	7.7
TkA04G020890	`PF07723`	LRR_2	192	197	0.017	16.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card