RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G017730
Reference: TK1151 Chr: Chr04 Coordinates: 4439395-4441543 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

927 bp · TkA04G017730|TK1151|cDNA

GACCCGCTTGATGATAATGTTATCCCCATTGTTGAAGAGCTTCAAAGAAGGCTGACTCCAGTTAAGCTCGATTTTACAGGGCATGGTGACGATGCCGACGGCACTGGGGTTCCATCCGACGAATTCCCATTTGAATTCCGAGCTCTTGAAGTCGCACTAGAAGGTATCTGTAGCTTTCTTGATGCACGCACGAGAGAACTGGAAACCGCTGCGTACCCTGCTTTAGATGAGCTCACGTCCATGATTAGCAGTCGTAACCT...

CDS

Download CDS FASTA

927 bp · TkA04G017730|TK1151|CDS

GACCCGCTTGATGATAATGTTATCCCCATTGTTGAAGAGCTTCAAAGAAGGCTGACTCCAGTTAAGCTCGATTTTACAGGGCATGGTGACGATGCCGACGGCACTGGGGTTCCATCCGACGAATTCCCATTTGAATTCCGAGCTCTTGAAGTCGCACTAGAAGGTATCTGTAGCTTTCTTGATGCACGCACGAGAGAACTGGAAACCGCTGCGTACCCTGCTTTAGATGAGCTCACGTCCATGATTAGCAGTCGTAACCT...

Protein

Download Protein FASTA

308 aa · TkA04G017730|TK1151|PROTEIN

DPLDDNVIPIVEELQRRLTPVKLDFTGHGDDADGTGVPSDEFPFEFRALEVALEGICSFLDARTRELETAAYPALDELTSMISSRNLDRVRKLKSTMTRLTNRVQKVRDELEQLLDDDDDMADLYLSRKLSFASSPSSNGGDFTWSPPSPTIESKISRASRTTPFSNHGENDVEELEMLLEAYFMQIEATSNKLTTLREYIDDTEDYINIQLDNHRNQLIQLELFLLSGTVSLSVYSLIAAIFGMNIPYPWNKHHGYAFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G017730
TK1151 IDTkA04G017730
OH-1004 IDLXL04_036913
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)97.400
Protein coverage (%)TK1151 85.065 / OH-1004 68.274
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G017730
LocationChr04:4439395-4441543 (+)
DescriptionSimilar to MRS2-I: Magnesium transporter MRS2-I
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g64560 Low-affinity magnesium transporter that mediates the influx of magnesium.
Magnesium transporter AtMGT9 is essential for pollen development in Arabidopsis.2009 · DOI: 10.1038/cr.2009.58
At5g09690 Low-affinity magnesium transporter that mediates the influx of magnesium.
AtMGT7: An Arabidopsis gene encoding a low-affinity magnesium transporter.2008 · DOI: 10.1111/j.1744-7909.2008.00770.x
UniProt: P0CZ21 Magnesium transporter that may mediate the influx of magnesium. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
UniProt: B8AJT9 Magnesium transporter that may mediate the influx of magnesium. No verified direct reference in this release
Os03g0742400 Magnesium transporter that may mediate the influx of magnesium. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036913 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009555 pollen development Biological Process
GO:0015693 magnesium ion transport Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0005789 endoplasmic reticulum membrane Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0016020 membrane Cellular Component
GO:0015095 magnesium ion transmembrane transporter activity Molecular Function
KEGG gene cross-reference
ath:AT5G09690
ath:AT5G64560
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.273
Rank 1 · TkA04G017730 · TK1151
Lysosome / Vacuole0.217
Rank 2 · TkA04G017730 · TK1151
Endoplasmic reticulum0.164
Rank 3 · TkA04G017730 · TK1151
Cytoplasm0.146
Rank 4 · TkA04G017730 · TK1151
Golgi apparatus0.131
Rank 5 · TkA04G017730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01442Apolipoprotein11-21 aa
PF22099MRS2-like39-130 aa
PF01442Apolipoprotein59-203 aa
PF08663HalX60-79 aa
PF25974GVIN164-133 aa
PF01544CorA65-128 aa
PF07426Dynactin_p2272-118 aa
PF29562DUF856776-114 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G017730PF01442Apolipoprotein11210.09513.1
TkA04G017730PF22099MRS2-like391301.7e-2487.1
TkA04G017730PF01442Apolipoprotein592030.09513.1
TkA04G017730PF08663HalX60793.28.9
TkA04G017730PF25974GVIN1641330.212.4
TkA04G017730PF01544CorA651283.9e-0730.4
TkA04G017730PF07426Dynactin_p22721180.1412.7
TkA04G017730PF29562DUF8567761140.05414.0
TkA04G017730PF00038Filament821180.001818.7
TkA04G017730PF10805DUF2730831250.0913.8
TkA04G017730PF14584DUF4446841150.2212.3
TkA04G017730PF14712Snapin_Pallidin851140.4711.7
TkA04G017730PF05377FlaC_arch891190.08814.0
TkA04G017730PF25450Rab11-FIP3901170.2712.2
TkA04G017730PF08663HalX981233.28.9
TkA04G017730PF18593CdiI_21021360.213.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FLG2Arabidopsis thalianasp|Q9FLG2|MRS22_ARATH Magnesium transporter MRS2-274.100%Swiss-ProtHigh
Q304A0Arabidopsis thalianasp|Q304A0|MRS27_ARATH Magnesium transporter MRS2-768.300%Swiss-ProtHigh
P0CZ21Arabidopsis thalianasp|P0CZ21|MRS28_ARATH Magnesium transporter MRS2-860.400%Swiss-ProtHigh
B8AJT9Oryza sativa subsp. indicasp|B8AJT9|MRS2I_ORYSI Magnesium transporter MRS2-I77.600%Swiss-ProtHigh
Q10D38Oryza sativa subsp. japonicasp|Q10D38|MRS2I_ORYSJ Magnesium transporter MRS2-I77.600%Swiss-ProtHigh

JBrowse

View in Genome Browser