TkA04G013520 | RubberDandelionOmics

Gene overview

TkA04G013520

Reference: TK1151 Chr: Chr04 Coordinates: 3369827-3376381 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3070 bp · TkA04G013520|TK1151|cDNA

ATTAAGAACTGCCATTATCGCCTTTTCCCTGAGTTTTTAAGGCAGTTAATGATCGAATTGTAACCTTAAAATCTGATTATCTTCAGATATTCATATCCAGATTTAAGAGAATTAAAATTTCCAAACGCATAAACCCCTCGGAAATCACAAATTCCTCCTGCTTGCTTTTTTATTCAGATGCTGCTGACAGAGTACAGAAAAATAAAGAGTAAAATAAAACCCAAAAACCCAAACGAAAACACACACACAAACAGATACCG...

CDS

Download CDS FASTA

3261 bp · TkA04G013520|TK1151|CDS

ATGAAATTGAGATCGAGTAAAGCTTTAGAAACGGGGAGACTCGGTGTTGTTTTGGGTATTGAGAATACCAAAGCTCCTAGCGCAAAGTGGATATCAAGACGCTTAGGTACATCAAATTCCGGTATAAATGAAGCACGTGAGGCTGAGAGGTTTTCACTGAGGTCTTGTAAATCCAATTTTGGTAAGAAAGGAGCAAATGAGGATGATATTAGGGTATGTATTGATAATGTTGATGAAGATAAAGGGTTGTTTTTGGGATC...

Protein

Download Protein FASTA

1086 aa · TkA04G013520|TK1151|PROTEIN

MKLRSSKALETGRLGVVLGIENTKAPSAKWISRRLGTSNSGINEAREAERFSLRSCKSNFGKKGANEDDIRVCIDNVDEDKGLFLGSEVLDPIKDLQVSFPDGEIKEESVERVHVEEGNKSSTSDIVNGDLSLLNDSKNGDGGADKIVHKRGPGRPRKKKRKIMAVSGGDMVVYGGESVTIKRKRGRKRKNIEDSECNENEKSRKKKVEVRVSERVLELKSKAVTGGGGMVVDGGRPEKKKKKKKLETRGRPRKKPIKTK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G013520`
TK1151 ID	TkA04G013520
OH-1004 ID	LXL04_018805
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	55.500
Protein coverage (%)	TK1151 51.750 / OH-1004 43.661 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G013520

Location Chr04:3369827-3376381 (+)

Description Similar to IDM1: Increased DNA methylation 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g14980`	Histone H3 acetyltransferase that binds methylated DNA at chromatin sites lacking histone H3K4 di- or trimethylation and catalyzes H3K18 and H3K23 acetylation.	A histone acetyltransferase regulates active DNA demethylation in Arabidopsis.2012 · DOI: 10.1126/science.1219416 Antisilencing role of the RNA-directed DNA methylation pathway and a histone acetyltransferase in Arabidopsis.2012 · DOI: 10.1073/pnas.1208557109 Regulation of active DNA demethylation by an α-crystallin domain protein in Arabidopsis.2014 · DOI: 10.1016/j.molcel.2014.06.008

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018805 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006412 translation Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT3G04920

ath:AT3G14980

ath:AT5G28060

ddi:DDB_G0275473

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · TkA04G013520 · TK1151

Cytoplasm0.068

Rank 2 · TkA04G013520 · TK1151

Cell membrane0.024

Rank 3 · TkA04G013520 · TK1151

Endoplasmic reticulum0.012

Rank 4 · TkA04G013520 · TK1151

Plastid0.011

Rank 5 · TkA04G013520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21571ArgZ-like_C_1st160-210 aa

PF22970DUF7028374-431 aa

PF21571ArgZ-like_C_1st467-503 aa

PF16744zf-RING_15561-579 aa

PF16135TDBD565-614 aa

PF00628PHD572-580 aa

PF23011PHD-1st_NSD572-582 aa

PF16744zf-RING_15639-668 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G013520	`PF21571`	ArgZ-like_C_1st	160	210	3.9	8.2
TkA04G013520	`PF22970`	DUF7028	374	431	6e-09	36.5
TkA04G013520	`PF21571`	ArgZ-like_C_1st	467	503	3.9	8.2
TkA04G013520	`PF16744`	zf-RING_15	561	579	3.2	8.7
TkA04G013520	`PF16135`	TDBD	565	614	1.2e-15	57.9
TkA04G013520	`PF00628`	PHD	572	580	2.5e-07	31.3
TkA04G013520	`PF23011`	PHD-1st_NSD	572	582	0.0023	18.8
TkA04G013520	`PF16744`	zf-RING_15	639	668	3.2	8.7
TkA04G013520	`PF23011`	PHD-1st_NSD	640	682	0.0023	18.8
TkA04G013520	`PF23004`	PHDvar_NSD	642	668	2.2	9.1
TkA04G013520	`PF00628`	PHD	643	682	2.5e-07	31.3
TkA04G013520	`PF15446`	zf-PHD-like	643	668	0.52	10.5
TkA04G013520	`PF30811`	PHD_UBR7-like	651	687	0.013	16.2
TkA04G013520	`PF13831`	PHD_2	652	682	0.00073	19.7
TkA04G013520	`PF16866`	PHD_4	683	719	3.2	8.5
TkA04G013520	`PF00628`	PHD	684	718	2.5e-07	31.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IXE7`	Arabidopsis thaliana	sp\|F4IXE7\|IDM1_ARATH Increased DNA methylation 1	40.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card