TkA04G011390 | RubberDandelionOmics

Gene overview

TkA04G011390

Reference: TK1151 Chr: Chr04 Coordinates: 2773810-2775195 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1242 bp · TkA04G011390|TK1151|cDNA

GAGAGAGAGAGAGAGAAAGAAGCGATTCGATCGGTGTTTTTGAAGTAAAAAATGGAAAATTTGGGACGATTTGATGTGATTGTAATCGGAGCCGGTGTGATGGGGAGTTCGACGGCATATCAAGCAGCTAAACGTGGTCAAAAAACTCTACTCGTCGAGCAATTCGACTTCCTACACTACCGTGGATCATCTCACGGCGAATCTCGAACAATCCGAGCAACTTATCCTGAACCATACTATGTTCCGATGGCAATTGAATC...

CDS

Download CDS FASTA

1122 bp · TkA04G011390|TK1151|CDS

ATGGAAAATTTGGGACGATTTGATGTGATTGTAATCGGAGCCGGTGTGATGGGGAGTTCGACGGCATATCAAGCAGCTAAACGTGGTCAAAAAACTCTACTCGTCGAGCAATTCGACTTCCTACACTACCGTGGATCATCTCACGGCGAATCTCGAACAATCCGAGCAACTTATCCTGAACCATACTATGTTCCGATGGCAATTGAATCGGAGAAACTGTGGAGAGACGCAGAATCAGAAATCGGCTATAAAGTTTACTT...

Protein

Download Protein FASTA

373 aa · TkA04G011390|TK1151|PROTEIN

MENLGRFDVIVIGAGVMGSSTAYQAAKRGQKTLLVEQFDFLHYRGSSHGESRTIRATYPEPYYVPMAIESEKLWRDAESEIGYKVYFKAQQLDLGPVENSSLVALIANCEKHSLNHQILNRHRAKEYFTGKIELPDDWTAAVTELGGVLKPTKAVAMFQALAIKHGAALKDKTEIIDLVTDKHRGGVLVSSRSGETFWGKKCVVTAGAWVSKLIQKVSNGATILPIQPIETNVFYWKIKEGHEHDYTIESGFPSFASYGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G011390`
TK1151 ID	TkA04G011390
OH-1004 ID	LXL04_036997
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G011390

Location Chr04:2773810-2775195 (+)

Description Similar to At2g24580: Probable sarcosine oxidase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g24580`	Probable sarcosine oxidase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036997 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006554 lysine catabolic process Biological Process

GO:0033514 L-lysine catabolic process to acetyl-CoA via L-pipecolate Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005782 peroxisomal matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0008115 sarcosine oxidase activity Molecular Function

GO:0050031 L-pipecolate oxidase activity Molecular Function

GO:0050660 flavin adenine dinucleotide binding Molecular Function

KEGG gene cross-reference

ath:AT2G24580

bta:509102

hsa:51268

mmu:19193

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.591

Rank 1 · TkA04G011390 · TK1151

Peroxisome0.331

Rank 2 · TkA04G011390 · TK1151

Nucleus0.216

Rank 3 · TkA04G011390 · TK1151

Mitochondrion0.103

Rank 4 · TkA04G011390 · TK1151

Cell membrane0.038

Rank 5 · TkA04G011390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01946Thi46-37 aa

PF01494FAD_binding_37-48 aa

PF01266DAO8-332 aa

PF12831FAD_oxidored8-41 aa

PF01134GIDA8-36 aa

PF00890FAD_binding_28-37 aa

PF07992Pyr_redox_28-43 aa

PF03486HI0933_like8-37 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G011390	`PF01946`	Thi4	6	37	0.016	15.2
TkA04G011390	`PF01494`	FAD_binding_3	7	48	0.056	13.4
TkA04G011390	`PF01266`	DAO	8	332	5.1e-40	138.8
TkA04G011390	`PF12831`	FAD_oxidored	8	41	9.9e-07	29.1
TkA04G011390	`PF01134`	GIDA	8	36	2.7e-06	27.4
TkA04G011390	`PF00890`	FAD_binding_2	8	37	1.4e-05	25.3
TkA04G011390	`PF07992`	Pyr_redox_2	8	43	0.0019	18.4
TkA04G011390	`PF03486`	HI0933_like	8	37	0.003	17.8
TkA04G011390	`PF02737`	3HCDH_N	9	37	0.002	18.8
TkA04G011390	`PF00070`	Pyr_redox	9	39	0.12	13.7
TkA04G011390	`PF03446`	NAD_binding_2	9	35	0.2	12.4
TkA04G011390	`PF13450`	NAD_binding_8	11	39	0.00044	21.2
TkA04G011390	`PF12831`	FAD_oxidored	120	193	9.9e-07	29.1
TkA04G011390	`PF03486`	HI0933_like	154	208	0.003	17.8
TkA04G011390	`PF00890`	FAD_binding_2	155	211	1.4e-05	25.3
TkA04G011390	`PF01134`	GIDA	175	216	2.7e-06	27.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJA7`	Arabidopsis thaliana	sp\|Q9SJA7\|SOX_ARATH Probable sarcosine oxidase	54.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card