TkA04G007250 | RubberDandelionOmics

Gene overview

TkA04G007250

Reference: TK1151 Chr: Chr04 Coordinates: 1723182-1724012 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

741 bp · TkA04G007250|TK1151|cDNA

ACTTATTACTGCAGAAGGATGGTTCAGTGATGCCTCTCACAATCAGGTTTGACAATTGACATGCCCAATTCTAATCCCTGTTATTTCATAATCTGCGTTACTCACATTGCAGGCTATGAGGTTTGGTGATCTTCCAGCATGGGCAACGGAGCTTTCAACATCTATACAGGAACTCATCCAGTATAGTGATTACGATCCTGATTCCATGGAAATGAATGAACAAGAATTCATATTTCCATCAGAGCTACTGATCAGGGAGC...

CDS

Download CDS FASTA

453 bp · TkA04G007250|TK1151|CDS

ATGAGGTTTGGTGATCTTCCAGCATGGGCAACGGAGCTTTCAACATCTATACAGGAACTCATCCAGTATAGTGATTACGATCCTGATTCCATGGAAATGAATGAACAAGAATTCATATTTCCATCAGAGCTACTGATCAGGGAGCCTCTCTTTAATCAACTCATTGTTAACTCATACCAGCCAGGTGAGGGAATTTGTGCACATGTGGATCTGATGCGATTTGAAGATGGGATAGCGCTTGTGTCTCTAGAATCATCTTG...

Protein

Download Protein FASTA

150 aa · TkA04G007250|TK1151|PROTEIN

MRFGDLPAWATELSTSIQELIQYSDYDPDSMEMNEQEFIFPSELLIREPLFNQLIVNSYQPGEGICAHVDLMRFEDGIALVSLESSCVMHFSRVENGDEKKIPVYLTPGCLLLISGESRYEWKHEINRKPGFQKWDGLEIDQKKRRTPLP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G007250`
TK1151 ID	TkA04G007250
OH-1004 ID	LXL04_037061
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 96.667 / OH-1004 58.468 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G007250`
Location	Chr04:1723182-1724012 (-)
Description	Similar to MIMI_L905: Uncharacterized protein L905
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037061` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002098 tRNA wobble uridine modification Biological Process GO:0006631 fatty acid metabolic process Biological Process GO:0006974 DNA damage response Biological Process GO:0030488 tRNA methylation Biological Process GO:0070988 demethylation Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005759 mitochondrial matrix Cellular Component GO:0005829 cytosol Cellular Component GO:0000049 tRNA binding Molecular Function
KEGG gene cross-reference	ath:AT1G31600 spo:2541495 vg:9925574 xtr:550051 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.581

Rank 1 · TkA04G007250 · TK1151

Nucleus0.572

Rank 2 · TkA04G007250 · TK1151

Mitochondrion0.067

Rank 3 · TkA04G007250 · TK1151

Cell membrane0.044

Rank 4 · TkA04G007250 · TK1151

Endoplasmic reticulum0.042

Rank 5 · TkA04G007250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF135322OG-FeII_Oxy_232-129 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G007250	`PF13532`	2OG-FeII_Oxy_2	32	129	2.6e-11	44.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card