TkA03G612680 | RubberDandelionOmics

Gene overview

TkA03G612680

Reference: TK1151 Chr: Chr03 Coordinates: 155630816-155636063 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3344 bp · TkA03G612680|TK1151|cDNA

GAAAGGGAAATAATCAAATAAGTCATAACTGGCTGGAACAGGATAAACACCGCGACACTCATCACTGAGTTGAAGACAGAGAATGATATTTTCGTTTTTAACGTTTTCTGTCCCTGCACTGCGACTCTGGAACCCACCTTTGCACTTCACCACGCCTTTCCCCTCTTCTAATCCATATACCGCCTCTTTTCACTTAACAAATAGCGTTTATCTTCGATTTCCCACCGGTGTCGTTATCTCAAGTTTGTAAATTGACTACT...

CDS

Download CDS FASTA

1986 bp · TkA03G612680|TK1151|CDS

ATGAGCAAGATTTTAGTGGATCCGAAAGGTTGCAGCATGGGTCAGATAACTATGTGTCTCTACCCACGGATGAATTTTCCTGTTCCAAATGAACAAACTTCAATCTGGAAGGACGTGCAGAAATACGATGGGAGTACAACATATGATGGTTCCTTAGAGTATTATGGGTACCCTTCAGATAAAAATGAATTACTTTTGCCTCAACCAAGAACAGATGCTGACTCTTCCATATTGCCATCTCAAGCACTTGAAGCTTCGAC...

Protein

Download Protein FASTA

661 aa · TkA03G612680|TK1151|PROTEIN

MSKILVDPKGCSMGQITMCLYPRMNFPVPNEQTSIWKDVQKYDGSTTYDGSLEYYGYPSDKNELLLPQPRTDADSSILPSQALEASTFPTYTPARNMYQSDADLYSTLFDQETPLASDSSLTIAQDQKFTIREISPDWAYATEPTKVLIVGSFTCDPSDSEWICMFGEMEVPVEIIQEGVICCQAPPHLPGKVTICITSGNREACSEVREFEYRDKPTIHVTETDESHRTPEELLLLVKFVHMLVLDKVGQNGNYIVADL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G612680`
TK1151 ID	TkA03G612680
OH-1004 ID	LXL04_015913
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	39.700
Protein coverage (%)	TK1151 77.307 / OH-1004 49.771 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G612680

Location Chr03:155630816-155636063 (+)

Description Similar to CAMTA3: Calmodulin-binding transcription activator 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67310`	Transcription activator that binds to the DNA consensus sequence 5'-[ACG]CGCG[GTC]-3' (By similarity).	No verified direct reference in this release
`At2g22300`	Transcription activator that binds to the DNA consensus sequence 5'-[ACG]CGCG[GTC]-3'.	Calmodulin-binding transcription activator (CAMTA) 3 mediates biotic defense responses in Arabidopsis.2008 · DOI: 10.1016/j.febslet.2008.02.037 Ca(2+)/calmodulin regulates salicylic-acid-mediated plant immunity.2009 · DOI: 10.1038/nature07612 Roles for Arabidopsis CAMTA transcription factors in cold-regulated gene expression and freezing tolerance.2009 · DOI: 10.1105/tpc.108.063958 Brush and spray: a high-throughput systemic acquired resistance assay suitable for large-scale genetic screening.2011 · DOI: 10.1104/pp.111.182089 The calmodulin-binding transcription factor SIGNAL RESPONSIVE1 is a novel regulator of glucosinolate metabolism and herbivory tolerance in Arabidopsis.2012 · DOI: 10.1093/pcp/pcs143 Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis.2013 · DOI: 10.1111/tpj.12205 A key general stress response motif is regulated non-uniformly by CAMTA transcription factors.2014 · DOI: 10.1111/tpj.12620 Distinct roles for mitogen-activated protein kinase signaling and CALMODULIN-BINDING TRANSCRIPTIONAL ACTIVATOR3 in regulating the peak time and amplitude of the plant general stress response.2014 · DOI: 10.1104/pp.114.245944 Different Cold-Signaling Pathways Function in the Responses to Rapid and Gradual Decreases in Temperature.2017 · DOI: 10.1105/tpc.16.00669 Matching NLR Immune Receptors to Autoimmunity in camta3 Mutants Using Antimorphic NLR Alleles.2017 · DOI: 10.1016/j.chom.2017.03.005
`At5g64220`	Transcription activator that binds to the DNA consensus sequence 5'-[ACG]CGCG[GTC]-3' (By similarity).	Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis.2013 · DOI: 10.1111/tpj.12205
`At5g09410`	Transcription activator that binds calmodulin in a calcium-dependent manner in vitro.	A novel family of calmodulin-binding transcription activators in multicellular organisms.2002 · DOI: 10.1074/jbc.m200268200 Arabidopsis CAMTA family proteins enhance V-PPase expression in pollen.2003 · DOI: 10.1093/pcp/pcg137 Roles for Arabidopsis CAMTA transcription factors in cold-regulated gene expression and freezing tolerance.2009 · DOI: 10.1105/tpc.108.063958 Calmodulin-binding transcription activator 1 mediates auxin signaling and responds to stresses in Arabidopsis.2010 · DOI: 10.1007/s00425-010-1153-6 CAMTA 1 regulates drought responses in Arabidopsis thaliana.2013 · DOI: 10.1186/1471-2164-14-216 Roles of CAMTA transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis.2013 · DOI: 10.1111/tpj.12205

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0490200`	Transcription activator that binds calmodulin in a calcium-dependent manner in vitro.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015913 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009733 response to auxin Biological Process

GO:0010150 leaf senescence Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0050826 response to freezing Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0070417 cellular response to cold Biological Process

KEGG gene cross-reference

ath:AT1G67310

ath:AT2G22300

ath:AT5G09410

ath:AT5G64220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.530

Rank 1 · TkA03G612680 · TK1151

Nucleus0.313

Rank 2 · TkA03G612680 · TK1151

Cell membrane0.152

Rank 3 · TkA03G612680 · TK1151

Golgi apparatus0.107

Rank 4 · TkA03G612680 · TK1151

Mitochondrion0.084

Rank 5 · TkA03G612680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01833TIG130-206 aa

PF12796Ank_2337-410 aa

PF13637Ank_4340-367 aa

PF00023Ank350-381 aa

PF13606Ank_3350-377 aa

PF13637Ank_4383-402 aa

PF00023Ank390-409 aa

PF13606Ank_3390-402 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G612680	`PF01833`	TIG	130	206	4.1e-07	30.6
TkA03G612680	`PF12796`	Ank_2	337	410	2.2e-10	41.7
TkA03G612680	`PF13637`	Ank_4	340	367	3e-05	24.9
TkA03G612680	`PF00023`	Ank	350	381	1.8e-08	34.9
TkA03G612680	`PF13606`	Ank_3	350	377	3.6e-06	27.6
TkA03G612680	`PF13637`	Ank_4	383	402	3e-05	24.9
TkA03G612680	`PF00023`	Ank	390	409	1.8e-08	34.9
TkA03G612680	`PF13606`	Ank_3	390	402	3.6e-06	27.6
TkA03G612680	`PF00612`	IQ	465	481	1.4e-10	40.7
TkA03G612680	`PF00612`	IQ	514	533	1.4e-10	40.7
TkA03G612680	`PF00612`	IQ	538	556	1.4e-10	40.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FYG2`	Arabidopsis thaliana	sp\|Q9FYG2\|CMTA4_ARATH Calmodulin-binding transcription activator 4	55.900%	Swiss-Prot	High
`Q8GSA7`	Arabidopsis thaliana	sp\|Q8GSA7\|CMTA3_ARATH Calmodulin-binding transcription activator 3	36.600%	Swiss-Prot	Medium
`Q6NPP4`	Arabidopsis thaliana	sp\|Q6NPP4\|CMTA2_ARATH Calmodulin-binding transcription activator 2	33.900%	Swiss-Prot	Medium
`Q9FY74`	Arabidopsis thaliana	sp\|Q9FY74\|CMTA1_ARATH Calmodulin-binding transcription activator 1	34.100%	Swiss-Prot	Medium
`Q7XHR2`	Oryza sativa subsp. japonica	sp\|Q7XHR2\|CBT_ORYSJ Calmodulin-binding transcription activator CBT	32.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card