TkA03G586170 | RubberDandelionOmics

Gene overview

TkA03G586170

Reference: TK1151 Chr: Chr03 Coordinates: 148914709-148917039 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

933 bp · TkA03G586170|TK1151|cDNA

ATGCGCCAAGGCCCCTTGGCGTGTGCCAACACCACCCCCTACACTATGCTAACCATTCATGCCAAGCTGCCACCGTTTTCCGACATTGACGCCGCTCGTTGTTCTACTTTCACGCTGTCCCCTCTGCCTGTTCTCTCTTGTGCTGCCGACGCTCTCCGATATTCACACCTTTTTCCCGTCCGCCGCCGCAGGATTGTGTCGAAGCTGTGCATGACTTTATTTAACACCGCCTGTTACACACATGAAAATCTCATCTCTGT...

CDS

Download CDS FASTA

933 bp · TkA03G586170|TK1151|CDS

ATGCGCCAAGGCCCCTTGGCGTGTGCCAACACCACCCCCTACACTATGCTAACCATTCATGCCAAGCTGCCACCGTTTTCCGACATTGACGCCGCTCGTTGTTCTACTTTCACGCTGTCCCCTCTGCCTGTTCTCTCTTGTGCTGCCGACGCTCTCCGATATTCACACCTTTTTCCCGTCCGCCGCCGCAGGATTGTGTCGAAGCTGTGCATGACTTTATTTAACACCGCCTGTTACACACATGAAAATCTCATCTCTGT...

Protein

Download Protein FASTA

310 aa · TkA03G586170|TK1151|PROTEIN

MRQGPLACANTTPYTMLTIHAKLPPFSDIDAARCSTFTLSPLPVLSCAADALRYSHLFPVRRRRIVSKLCMTLFNTACYTHENLISVLGFCDEDGEKILLYEGLLRPAYTTTIDWSKWRIFWADERVVPNNHVDSNFKLANDLLLAMLPIIPSCVYTIKDTLHSQEAASQYGNVIRELVRTRVIKASRSNDCQKFDLILLDMGVDGHVASLFPNHRVLEVKREWVTVVVNSPKHPPERITFTLPVINSAANVVVVATVEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G586170`
TK1151 ID	TkA03G586170
OH-1004 ID	LXL04_011392
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G586170

Location Chr03:148914709-148917039 (-)

Description Similar to PGL1: Probable 6-phosphogluconolactonase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13700`	Catalyzes the hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XI04`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release
`Os03g0416500`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release
`UniProt: A2YNH4`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release
`Os07g0604000`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011392 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006098 pentose-phosphate shunt Biological Process

GO:0009051 pentose-phosphate shunt, oxidative branch Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0017057 6-phosphogluconolactonase activity Molecular Function

KEGG gene cross-reference

ath:AT1G13700

dosa:Os03g0416500

dosa:Os07g0604000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.456

Rank 1 · TkA03G586170 · TK1151

Nucleus0.335

Rank 2 · TkA03G586170 · TK1151

Mitochondrion0.157

Rank 3 · TkA03G586170 · TK1151

Plastid0.101

Rank 4 · TkA03G586170 · TK1151

Peroxisome0.057

Rank 5 · TkA03G586170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01182Glucosamine_iso100-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G586170	`PF01182`	Glucosamine_iso	100	270	4.5e-51	174.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMX8`	Arabidopsis thaliana	sp\|Q9LMX8\|6PGL1_ARATH Probable 6-phosphogluconolactonase 1	57.600%	Swiss-Prot	Medium
`A2XI04`	Oryza sativa subsp. indica	sp\|A2XI04\|6PGL1_ORYSI Probable 6-phosphogluconolactonase 1	56.600%	Swiss-Prot	Medium
`Q75IV7`	Oryza sativa subsp. japonica	sp\|Q75IV7\|6PGL1_ORYSJ Probable 6-phosphogluconolactonase 1	56.600%	Swiss-Prot	Medium
`A2YNH4`	Oryza sativa subsp. indica	sp\|A2YNH4\|6PGL2_ORYSI Probable 6-phosphogluconolactonase 2	55.400%	Swiss-Prot	Medium
`Q6Z4H0`	Oryza sativa subsp. japonica	sp\|Q6Z4H0\|6PGL2_ORYSJ Probable 6-phosphogluconolactonase 2	55.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card