TkA03G581110 | RubberDandelionOmics

Gene overview

TkA03G581110

Reference: TK1151 Chr: Chr03 Coordinates: 147472364-147474666 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1525 bp · TkA03G581110|TK1151|cDNA

CTAATATGCACCTACAAAGTTCCTACATTTGAAACCCTAAAACTTTCCTTCCAATCTGCAAATAACTCACCATGTCTCATGATAAGGCCGTTGAAAGGGGAAAAGACTCACCGTTGGCCCCTATGTCGACGGCACTTGTCGCCGTGACCAACGGGAATGGCAACGGAACTGGAGCAGCGCCGTCCAACGCCAGCTACCGTCTCCGATTGAACCCTAATCAAGACCACAAGGCGGATAACTATGACGATCTAGGGTTGGAG...

CDS

Download CDS FASTA

1197 bp · TkA03G581110|TK1151|CDS

ATGTCTCATGATAAGGCCGTTGAAAGGGGAAAAGACTCACCGTTGGCCCCTATGTCGACGGCACTTGTCGCCGTGACCAACGGGAATGGCAACGGAACTGGAGCAGCGCCGTCCAACGCCAGCTACCGTCTCCGATTGAACCCTAATCAAGACCACAAGGCGGATAACTATGACGATCTAGGGTTGGAGTTCACTCCCCTGCTTTTCAGCTCCCTGGAGCGATACTTGCCGCCAAACCTCTTGAAAGACTCTCGAGACAT...

Protein

Download Protein FASTA

398 aa · TkA03G581110|TK1151|PROTEIN

MSHDKAVERGKDSPLAPMSTALVAVTNGNGNGTGAAPSNASYRLRLNPNQDHKADNYDDLGLEFTPLLFSSLERYLPPNLLKDSRDIKYKYMRDILRRYSTEGERTRDQKHREYRQKIISNYQPLYRELYTLNPSTFFVPSFAKAFTANDKNRDENIRSIMSEPAPGVYTFDMLQPRFCEMLLSEVENFEKWVHETKFRIMRPNTMNKFGAVLDDFGMESMLEKLMEDFIRHISKIFYLDVGGYSLDSHHGFVVEYGMDR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G581110`
TK1151 ID	TkA03G581110
OH-1004 ID	LXL04_011295
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G581110

Location Chr03:147472364-147474666 (+)

Description Similar to CP2: 2-oxoglutarate and iron-dependent oxygenase domain-containing protein CP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18210`	Participates in the epigenetic repression of flowering genes in association with ICU11.	No verified direct reference in this release
`At1g22950`	Participates in the epigenetic repression of flowering genes in association with CP2.	INCURVATA11 and CUPULIFORMIS2 Are Redundant Genes That Encode Epigenetic Machinery Components in Arabidopsis.2018 · DOI: 10.1105/tpc.18.00300

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011295 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0016604 nuclear body Cellular Component

GO:0005506 iron ion binding Molecular Function

GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function

GO:0031418 L-ascorbic acid binding Molecular Function

GO:0051213 dioxygenase activity Molecular Function

KEGG gene cross-reference

ath:AT1G22950

ath:AT3G18210

dre:790923

hsa:79676

xtr:734070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.591

Rank 1 · TkA03G581110 · TK1151

Cytoplasm0.453

Rank 2 · TkA03G581110 · TK1151

Mitochondrion0.060

Rank 3 · TkA03G581110 · TK1151

Cell membrane0.052

Rank 4 · TkA03G581110 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkA03G581110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25238OGFOD2-like118-243 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G581110	`PF25238`	OGFOD2-like	118	243	7.6e-53	178.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0DO23`	Arabidopsis thaliana	sp\|P0DO23\|CP2_ARATH 2-oxoglutarate and iron-dependent oxygenase domain-containing protein CP2	65.900%	Swiss-Prot	High
`Q3ED68`	Arabidopsis thaliana	sp\|Q3ED68\|ICU11_ARATH 2-oxoglutarate and iron-dependent oxygenase domain-containing protein ICU11	60.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card