TkA03G579400 | RubberDandelionOmics

Gene overview

TkA03G579400

Reference: TK1151 Chr: Chr03 Coordinates: 147009650-147011311 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1201 bp · TkA03G579400|TK1151|cDNA

AGAAGCGTTATTTTCTTTATAGGATAGTATAGATAACAACGCCAGGTCGCCAGCTCCAAATCATCGTCCCGAAAAGCTTTGTTCACCTCATATTTTGACAATGGGCGATTGATAAACTTTCATATAGAGTAGGGTGTTATTTGTATATTTGACCACCACCTACTCTAATAGCCGTTCTAAAAAATAGCGTCTACTCTAAAGAGAGTTGTTCACGCCCAAAATTAGGCGAAATCCCCAATCTTTCGATAGAAACGAAGGGT...

CDS

Download CDS FASTA

633 bp · TkA03G579400|TK1151|CDS

ATGTCGCAGGCAGTCTTCTCGCCGGGGAACGCCATCATTCCGGCGTCACGTCTAAAGACGTTGTCCGCCAACGCCCTCTACCTTCCCTCATCAAACGTTCAGTTACTCCGACCAACGAACCACCACCGGCAGCGGCGGTTGCGGTCACTCACAACGCCTGTTAGGTGCAGCACCAATTTCTCCTTTGATCTCAAAGGTGGCAAAGGAATGAATAAATTTCACGAGTATGAAGTCAGAGTTAGAGATTACGAATTGGATCA...

Protein

Download Protein FASTA

210 aa · TkA03G579400|TK1151|PROTEIN

MSQAVFSPGNAIIPASRLKTLSANALYLPSSNVQLLRPTNHHRQRRLRSLTTPVRCSTNFSFDLKGGKGMNKFHEYEVRVRDYELDQYGVVNNAVFANYCQDARRELLQKIGINIDTVAKSGNAIAISDLSLKFLGPLRIGDRFTVRVRISDSSAARIYFEHFIFKIPNEEPILEARATAVWLDKNYRPVRVPPEVRSKLVQFLRHDEGN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G579400`
TK1151 ID	TkA03G579400
OH-1004 ID	LXL04_011274
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	79.100
Protein coverage (%)	TK1151 98.571 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G579400

Location Chr03:147009650-147011311 (-)

Description Similar to ALT3: Acyl-acyl carrier protein thioesterase ATL3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68260`	Acyl-ACP thioesterase involved in the production of fatty acids and beta-keto fatty acids.	Acyl-lipid thioesterase1-4 from Arabidopsis thaliana form a novel family of fatty acyl-acyl carrier protein thioesterases with divergent expression patterns and substrate specificities.2014 · DOI: 10.1007/s11103-013-0151-z
`At1g68280`	Acyl-ACP thioesterase involved in the production of fatty acids and beta-keto fatty acids.	Acyl-lipid thioesterase1-4 from Arabidopsis thaliana form a novel family of fatty acyl-acyl carrier protein thioesterases with divergent expression patterns and substrate specificities.2014 · DOI: 10.1007/s11103-013-0151-z
`At1g35290`	Acyl-ACP thioesterase involved in the production of fatty acids and beta-keto fatty acids.	Acyl-lipid thioesterase1-4 from Arabidopsis thaliana form a novel family of fatty acyl-acyl carrier protein thioesterases with divergent expression patterns and substrate specificities.2014 · DOI: 10.1007/s11103-013-0151-z
`At1g35250`	Acyl-ACP thioesterase involved in the production of fatty acids and beta-keto fatty acids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011274 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006629 lipid metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016297 fatty acyl-[ACP] hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G35250

ath:AT1G35290

ath:AT1G68260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.810

Rank 1 · TkA03G579400 · TK1151

Mitochondrion0.202

Rank 2 · TkA03G579400 · TK1151

Cytoplasm0.077

Rank 3 · TkA03G579400 · TK1151

Peroxisome0.047

Rank 4 · TkA03G579400 · TK1151

Nucleus0.030

Rank 5 · TkA03G579400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21830DUF689026-33 aa

PF20791Acyl-ACP_TE_C72-103 aa

PF132794HBT_280-200 aa

PF030614HBT88-170 aa

PF21830DUF6890168-187 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G579400	`PF21830`	DUF6890	26	33	0.17	12.2
TkA03G579400	`PF20791`	Acyl-ACP_TE_C	72	103	0.13	13.2
TkA03G579400	`PF13279`	4HBT_2	80	200	1.1e-20	75.0
TkA03G579400	`PF03061`	4HBT	88	170	3.2e-10	40.9
TkA03G579400	`PF21830`	DUF6890	168	187	0.17	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W583`	Arabidopsis thaliana	sp\|Q8W583\|ALT3_ARATH Acyl-acyl carrier protein thioesterase ATL3, chloroplastic	64.500%	Swiss-Prot	High
`F4HX80`	Arabidopsis thaliana	sp\|F4HX80\|ALT4_ARATH Acyl-acyl carrier protein thioesterase ATL4, chloroplastic	60.600%	Swiss-Prot	High
`Q9C7I5`	Arabidopsis thaliana	sp\|Q9C7I5\|ALT1_ARATH Acyl-acyl carrier protein thioesterase ATL1, chloroplastic	57.400%	Swiss-Prot	High
`Q9C7I8`	Arabidopsis thaliana	sp\|Q9C7I8\|ALT2_ARATH Acyl-acyl carrier protein thioesterase ATL2, chloroplastic	58.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card