TkA03G561690 | RubberDandelionOmics

Gene overview

TkA03G561690

Reference: TK1151 Chr: Chr03 Coordinates: 142532719-142534923 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1109 bp · TkA03G561690|TK1151|cDNA

TCGCCCATAGAAAAGAAAAACCCATTATTTGTATACACGAAAAACCCATCAAAACTGGCGAGCTTCAGTGAACCAGAAACATCGGCAGTCAGCACGAAGATGGAGACTGAAACGGCGACACGGAGAGTTGCGATGATCACTGCTCACTTCTCCGCCGCCGACAACATCTCTGCCACCGGAGTTGCAACTCATGTCTTCCCTCTGAGTTGCAGCAGTGGGTTAACATCTATCAGCAGGAGATTAGATAATCGTATGAATTT...

CDS

Download CDS FASTA

840 bp · TkA03G561690|TK1151|CDS

TCGCCCATAGAAAAGAAAAACCCATTATTTGTATACACGAAAAACCCATCAAAACTGGCGAGCTTCAGTGAACCAGAAACATCGGCAGTCAGCACGAAGATGGAGACTGAAACGGCGACACGGAGAGTTGCGATGATCACTGCTCACTTCTCCGCCGCCGACAACATCTCTGCCACCGGAGTTGCAACTCATGTCTTCCCTCTGAGTTGCAGCAGTGGGTTAACATCTATCAGCAGGAGATTAGATAATCGTATGAATTT...

Protein

Download Protein FASTA

279 aa · TkA03G561690|TK1151|PROTEIN

SPIEKKNPLFVYTKNPSKLASFSEPETSAVSTKMETETATRRVAMITAHFSAADNISATGVATHVFPLSCSSGLTSISRRLDNRMNFARQDSRSQPNYMRQISKQQGSSELVPPMFSQPTTNNFDAPKVREIQYVVEDYKLPSSQPPKFARTTDETDVPMKFIPYNNTHATKHLGVERKQKQSPRMDVVESGGKYILAIELPGVSIDDIRVEVNNTTLTVQTTKGRTITNSAYHKREILEGPFEVMWPLPFDVNPDSVSA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G561690`
TK1151 ID	TkA03G561690
OH-1004 ID	LXL04_011040
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 93.548 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G561690`
Location	Chr03:142532719-142534923 (+)
Description	Similar to hspC2: Small heat shock protein C2 (Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011040` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	cac:CA_C3714 ddi:DDB_G0280215 rfe:RF_1004 rfe:RF_p51 rfe:RF_pd51 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.449

Rank 1 · TkA03G561690 · TK1151

Nucleus0.374

Rank 2 · TkA03G561690 · TK1151

Cell membrane0.115

Rank 3 · TkA03G561690 · TK1151

Mitochondrion0.095

Rank 4 · TkA03G561690 · TK1151

Endoplasmic reticulum0.070

Rank 5 · TkA03G561690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27746Small_heat_shock_put172-271 aa

PF31004IDM_C185-271 aa

PF00011HSP20188-274 aa

PF17886ArsA_HSP20192-269 aa

PF18201PIH1_CS194-263 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G561690	`PF27746`	Small_heat_shock_put	172	271	0.0034	17.4
TkA03G561690	`PF31004`	IDM_C	185	271	0.0015	18.9
TkA03G561690	`PF00011`	HSP20	188	274	1.7e-12	48.0
TkA03G561690	`PF17886`	ArsA_HSP20	192	269	3.2e-05	24.1
TkA03G561690	`PF18201`	PIH1_CS	194	263	0.092	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card