Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1800 bp · TkA03G560870|TK1151|cDNA
ATGGCAATTTCCACTTCTTCCGAGTGGTCATTAGCGTGCGTTCATTGCATCAAAAGAACCCACAAAAACCTCACCTTCAATCCGTCGATTCTTCTCTTCATCTCTCCCCCTTTCTCATCTTCTTCGAGAATCCTGATCCTTAATTCCTCCAGAAGTTTCCCACCACCAATACTAGAAGAAATGGACCAGGAAGTTGAAGATCGTCGAGAATCATCGGTAATCGATGAAGAGAATCTCAATCAATCGATATGCAGTCTGTT...
1800 bp · TkA03G560870|TK1151|CDS
ATGGCAATTTCCACTTCTTCCGAGTGGTCATTAGCGTGCGTTCATTGCATCAAAAGAACCCACAAAAACCTCACCTTCAATCCGTCGATTCTTCTCTTCATCTCTCCCCCTTTCTCATCTTCTTCGAGAATCCTGATCCTTAATTCCTCCAGAAGTTTCCCACCACCAATACTAGAAGAAATGGACCAGGAAGTTGAAGATCGTCGAGAATCATCGGTAATCGATGAAGAGAATCTCAATCAATCGATATGCAGTCTGTT...
Protein
Download Protein FASTA599 aa · TkA03G560870|TK1151|PROTEIN
MAISTSSEWSLACVHCIKRTHKNLTFNPSILLFISPPFSSSSRILILNSSRSFPPPILEEMDQEVEDRRESSVIDEENLNQSICSLLKDPKTEEMGFESYQKAKTVPDFKPTRSTLHNLIRYSLRLKNWNSIWSIAEDFGKFKVYPNASSCCRLITSCIRAKRFKLASHLLHILKFEKEVAILSFNAAMRSYNKLHMYSSAVNVYEIMKSSGMQLDGECYGRTMEAYLKMGKNDKVISLFKEFEKSNLEWTPFCSQIYRI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G560870 |
|---|---|
| TK1151 ID | TkA03G560870 |
| OH-1004 ID | LXL04_011017 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 96.700 |
| Protein coverage (%) | TK1151 53.589 / OH-1004 54.351Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G560870 |
|---|---|
| Location | Chr03:142239153-142240982 (-) |
| Description | Similar to At5g13770: Pentatricopeptide repeat-containing protein At5g13770, chloroplastic |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006396 RNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0006417 regulation of translation Biological Process GO:0009658 chloroplast organization Biological Process GO:0010239 chloroplast mRNA processing Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0009507 chloroplast Cellular Component GO:0009534 chloroplast thylakoid Cellular Component GO:0009570 chloroplast stroma Cellular Component GO:0042644 chloroplast nucleoid Cellular Component GO:0042651 thylakoid membrane Cellular Component |
| KEGG gene cross-reference | ath:AT3G22470 ath:AT5G13770 ath:AT5G42310 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF29070MSC6_N104-213 aaPF26719TPR_Atp25_C107-135 aaPF13041PPR_2118-158 aaPF17177PPR_long142-245 aaPF13812PPR_3143-189 aaPF13041PPR_2146-172 aaPF01535PPR151-172 aaPF23276TPR_24151-279 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G560870 | PF29070 | MSC6_N | 104 | 213 | 3.1e-25 | 89.8 |
| TkA03G560870 | PF26719 | TPR_Atp25_C | 107 | 135 | 0.071 | 13.0 |
| TkA03G560870 | PF13041 | PPR_2 | 118 | 158 | 9.1e-44 | 148.1 |
| TkA03G560870 | PF17177 | PPR_long | 142 | 245 | 5.9e-19 | 69.0 |
| TkA03G560870 | PF13812 | PPR_3 | 143 | 189 | 3.6e-23 | 82.1 |
| TkA03G560870 | PF13041 | PPR_2 | 146 | 172 | 9.1e-44 | 148.1 |
| TkA03G560870 | PF01535 | PPR | 151 | 172 | 1.3e-41 | 138.7 |
| TkA03G560870 | PF23276 | TPR_24 | 151 | 279 | 1.6e-14 | 54.6 |
| TkA03G560870 | PF13041 | PPR_2 | 183 | 217 | 9.1e-44 | 148.1 |
| TkA03G560870 | PF01535 | PPR | 184 | 212 | 1.3e-41 | 138.7 |
| TkA03G560870 | PF00637 | Clathrin | 189 | 207 | 0.65 | 10.5 |
| TkA03G560870 | PF00515 | TPR_1 | 192 | 206 | 0.3 | 11.7 |
| TkA03G560870 | PF13176 | TPR_7 | 198 | 206 | 0.087 | 13.7 |
| TkA03G560870 | PF23276 | TPR_24 | 201 | 307 | 1.6e-14 | 54.6 |
| TkA03G560870 | PF29070 | MSC6_N | 207 | 315 | 3.1e-25 | 89.8 |
| TkA03G560870 | PF13812 | PPR_3 | 207 | 248 | 3.6e-23 | 82.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.