TkA03G557470 | RubberDandelionOmics

Gene overview

TkA03G557470

Reference: TK1151 Chr: Chr03 Coordinates: 141097337-141098582 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1014 bp · TkA03G557470|TK1151|cDNA

ATGAGTTCCCCAAGAAAGAATGCAGATAGGCTTAGCTCTTTGCCTGATGAGGTTCTTTCACATATACTCTCTTCAATGCCTACAAAATATGCAGTTCGAACAAGCAGTTTATCCAAAAGATGGAGGTACAATTGGACGACGGTCACAAACCTTGATTTTGACGATATTCATTCCTTTCAAGGGTTGGATTGCTTTTCGGAATTTGTAAATCGGGTATTGAAGCTATTGAAAACATCCAAAGTTAAACTATTGCGGTTACG...

CDS

Download CDS FASTA

1014 bp · TkA03G557470|TK1151|CDS

ATGAGTTCCCCAAGAAAGAATGCAGATAGGCTTAGCTCTTTGCCTGATGAGGTTCTTTCACATATACTCTCTTCAATGCCTACAAAATATGCAGTTCGAACAAGCAGTTTATCCAAAAGATGGAGGTACAATTGGACGACGGTCACAAACCTTGATTTTGACGATATTCATTCCTTTCAAGGGTTGGATTGCTTTTCGGAATTTGTAAATCGGGTATTGAAGCTATTGAAAACATCCAAAGTTAAACTATTGCGGTTACG...

Protein

Download Protein FASTA

337 aa · TkA03G557470|TK1151|PROTEIN

MSSPRKNADRLSSLPDEVLSHILSSMPTKYAVRTSSLSKRWRYNWTTVTNLDFDDIHSFQGLDCFSEFVNRVLKLLKTSKVKLLRLRFLEMWVKKSCVSNLIDKAVGLNVCEIDVQAYYFDFPPNMFTCKTLTKLRIVESSQSMKVLTFPTSVMLPCLKTLDICVFEKPYLSAFRLVNGSPVLESLSLKVTWRSEEEDYNFNIPTLKRFELRTTKVISIINKVVLNLPNLEYVFVGGRLCSLFVIEDLSSLVDANISFDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G557470`
TK1151 ID	TkA03G557470
OH-1004 ID	LXL04_035646
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	53.300
Protein coverage (%)	TK1151 100.000 / OH-1004 72.034 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G557470

Location Chr03:141097337-141098582 (-)

Description Similar to At4g10400: FBD-associated F-box protein At4g10400

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59200`	F-box/LRR-repeat protein At3g59200.	No verified direct reference in this release
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At4g14103`	F-box/LRR-repeat protein At4g14103.	No verified direct reference in this release
`At1g51370`	F-box/FBD/LRR-repeat protein At1g51370.	No verified direct reference in this release
`At2g05300`	Putative F-box/FBD/LRR-repeat protein At2g05300.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035646 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G13780

ath:AT1G78750

ath:AT1G78760

ath:AT4G10400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.840

Rank 1 · TkA03G557470 · TK1151

Cytoplasm0.232

Rank 2 · TkA03G557470 · TK1151

Endoplasmic reticulum0.033

Rank 3 · TkA03G557470 · TK1151

Cell membrane0.032

Rank 4 · TkA03G557470 · TK1151

Mitochondrion0.015

Rank 5 · TkA03G557470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box11-46 aa

PF12937F-box-like11-42 aa

PF00646F-box69-80 aa

PF24758LRR_At5g56370120-236 aa

PF23622LRR_At1g61320_AtMIF1129-201 aa

PF00646F-box150-164 aa

PF00646F-box219-230 aa

PF24758LRR_At5g56370285-328 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G557470	`PF00646`	F-box	11	46	2e-09	37.7
TkA03G557470	`PF12937`	F-box-like	11	42	5.8e-05	23.5
TkA03G557470	`PF00646`	F-box	69	80	2e-09	37.7
TkA03G557470	`PF24758`	LRR_At5g56370	120	236	1.6e-09	38.5
TkA03G557470	`PF23622`	LRR_At1g61320_AtMIF1	129	201	0.019	15.1
TkA03G557470	`PF00646`	F-box	150	164	2e-09	37.7
TkA03G557470	`PF00646`	F-box	219	230	2e-09	37.7
TkA03G557470	`PF24758`	LRR_At5g56370	285	328	1.6e-09	38.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX51`	Arabidopsis thaliana	sp\|Q9LX51\|FBL64_ARATH F-box/LRR-repeat protein At3g59200	35.500%	Swiss-Prot	Medium
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	30.300%	Swiss-Prot	Medium
`Q8L7H1`	Arabidopsis thaliana	sp\|Q8L7H1\|FBL75_ARATH F-box/LRR-repeat protein At4g14103	28.500%	Swiss-Prot	Low
`Q6DBN6`	Arabidopsis thaliana	sp\|Q6DBN6\|FDL6_ARATH F-box/FBD/LRR-repeat protein At1g51370	30.300%	Swiss-Prot	Medium
`Q9SJ32`	Arabidopsis thaliana	sp\|Q9SJ32\|FDL15_ARATH Putative F-box/FBD/LRR-repeat protein At2g05300	27.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card