Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2450 bp · TkA03G556390|TK1151|cDNA
TTGTTGTTTCTTGTTTGTCTTTCCCTCGACCCTCCGGTCACGTCATTTGGAAGTTTCTCCTCACTCTTTCTTTATGCCTTTTGCTTTCATCTTCAACGCAACAAGTTGGAAAATGAACCCCGAAGACGAAGTCAACCTCCATATCTTTTACCTTCCTTCAATCCCCTGTCAAACAACCAAACCTAGTAGTTCGCCTCTGGAAGACCCGACAAAAGCCCAGAAATTCAACAATCGTCGTTGCCCACCAACTGTTTGCCGAA...
1080 bp · TkA03G556390|TK1151|CDS
ATGACGGAGGTGGAGTATTTGTCGGCTTTGGTCAAATCTTTGACTCGTGAGGCTGAAGAACAAAAAGAGGCGGTGGGGTTGTTGTCGTCTCTTTCTGATGTTTCTTCTGTGAGAAGAAGAATTGGAAGGATTCAAGGATGTATAGTTATGCTTATTGCTATTTTTAATGGTGAAGATCAAACAGCTTCACAAGATGCAGGAAAGTTATTAGCTGCTTTATCTAGTAATACCCAGAATGCCCTTCATATGGCGGAAGCTGG...
Protein
Download Protein FASTA359 aa · TkA03G556390|TK1151|PROTEIN
MTEVEYLSALVKSLTREAEEQKEAVGLLSSLSDVSSVRRRIGRIQGCIVMLIAIFNGEDQTASQDAGKLLAALSSNTQNALHMAEAGYFKPLVKYLTEGSDMSKILMATAISRMELRDQTMASIGEDGAIPPLVKMFKEGKLESKLSSLSALQTLSTLKENTKRLINSGIVPSLLQLMFSVTSVLMTLREPASAILARIAKSNSMLVNHDIALQMFSLLNLSSPVIQHHLLEALNSIASHSTASKVRRKMKENGSIQLLL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA03G556390 |
|---|---|
| TK1151 ID | TkA03G556390 |
| OH-1004 ID | LXL04_010928 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.100 |
| Protein coverage (%) | TK1151 95.265 / OH-1004 35.812Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA03G556390 |
|---|---|
| Location | Chr03:140851759-140854835 (-) |
| Description | Similar to PUB44: U-box domain-containing protein 44 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006970 response to osmotic stress Biological Process GO:0009742 brassinosteroid mediated signaling pathway Biological Process GO:0010115 regulation of abscisic acid biosynthetic process Biological Process GO:0010150 leaf senescence Biological Process GO:0010271 regulation of chlorophyll catabolic process Biological Process GO:0010380 regulation of chlorophyll biosynthetic process Biological Process GO:0016567 protein ubiquitination Biological Process GO:0034614 cellular response to reactive oxygen species Biological Process GO:0048364 root development Biological Process GO:0048658 anther wall tapetum development Biological Process GO:0090359 negative regulation of abscisic acid biosynthetic process Biological Process GO:1904821 chloroplast disassembly Biological Process |
| KEGG gene cross-reference | ath:AT1G20780 ath:AT1G76390 ath:AT2G23140 dosa:Os03g0657100 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF23654ARM_LIN_2nd1-22 aaPF13877RPAP3_C3-35 aaPF25598ARM_PUB4-200 aaPF23227HEAT_MROH2B_C6-52 aaPF05804KAP7-176 aaPF24768ARM_ARMC58-100 aaPF30746TMCO68-97 aaPF30700ARM_GAC_1st11-137 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA03G556390 | PF23654 | ARM_LIN_2nd | 1 | 22 | 0.073 | 13.4 |
| TkA03G556390 | PF13877 | RPAP3_C | 3 | 35 | 0.21 | 12.8 |
| TkA03G556390 | PF25598 | ARM_PUB | 4 | 200 | 5.6e-10 | 39.8 |
| TkA03G556390 | PF23227 | HEAT_MROH2B_C | 6 | 52 | 0.06 | 13.4 |
| TkA03G556390 | PF05804 | KAP | 7 | 176 | 0.0014 | 17.7 |
| TkA03G556390 | PF24768 | ARM_ARMC5 | 8 | 100 | 1.1e-12 | 48.6 |
| TkA03G556390 | PF30746 | TMCO6 | 8 | 97 | 0.24 | 10.8 |
| TkA03G556390 | PF30700 | ARM_GAC_1st | 11 | 137 | 9.9e-05 | 20.5 |
| TkA03G556390 | PF13513 | HEAT_EZ | 20 | 29 | 0.03 | 15.6 |
| TkA03G556390 | PF00514 | Arm | 21 | 32 | 2.7e-11 | 43.8 |
| TkA03G556390 | PF12717 | Cnd1 | 22 | 120 | 0.039 | 14.7 |
| TkA03G556390 | PF25571 | TPR_CCP1_N | 69 | 112 | 1.7e-05 | 24.7 |
| TkA03G556390 | PF05804 | KAP | 69 | 342 | 0.0014 | 17.7 |
| TkA03G556390 | PF00514 | Arm | 76 | 110 | 2.7e-11 | 43.8 |
| TkA03G556390 | PF30700 | ARM_GAC_1st | 104 | 190 | 9.9e-05 | 20.5 |
| TkA03G556390 | PF24768 | ARM_ARMC5 | 115 | 241 | 1.1e-12 | 48.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.