TkA03G544120 | RubberDandelionOmics

Gene overview

TkA03G544120

Reference: TK1151 Chr: Chr03 Coordinates: 137211692-137214794 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1454 bp · TkA03G544120|TK1151|cDNA

AGCAATTATTTTACATCTATGGGAAATATACTTATACTTATAAATAATAAAGCAAATAAAATATATGGTTTTTGGTGATTAAATACACACCAGTTCCATATATCTTTTCCTTCACAACGTGTTCTCCCCCAAAACCTAGAGGGGGTTTTCATCTTCTTTCACGCAAAAAAGCTTAGATTCTCCATCACAGATACAACCAAGTCCATTTCAGTGGACTTTTGATGGACCAGTATGAGAAGGTTGAGAAGATTGGTGAAGGA...

CDS

Download CDS FASTA

885 bp · TkA03G544120|TK1151|CDS

ATGGACCAGTATGAGAAGGTTGAGAAGATTGGTGAAGGAACATATGGTGTAGTCTACAAGGCGCGTGACAAAATCACCAATGAAACTATTGCTTTAAAGAAGATTCGCCTCGAACAAGAAGATGAAGGAGTACCAAGCACAGCTATCAGAGAGATTTCTCTCCTGAAAGAAATGCAACATGGAAACATTGTCAGGTTACAAGATGTTGTGCACAGTGACAAAAGACTGTATCTGGTTTTCGAGTATCTTGACCTGGATTT...

Protein

Download Protein FASTA

294 aa · TkA03G544120|TK1151|PROTEIN

MDQYEKVEKIGEGTYGVVYKARDKITNETIALKKIRLEQEDEGVPSTAIREISLLKEMQHGNIVRLQDVVHSDKRLYLVFEYLDLDLKKHMDSCPEFSKDPRLVKTFLYQILRGIAYCHSHRVLHRDLKPQNLLIDRRTNALKLADFGLARAFGIPVRTFTHEVVTLWYRAPEILLGSRHYSTPVDVWSVGCIFAEMVNQRPLFPGDSEIDELFKIFRIMGTPNEDTWPGVTSLPDFKSAFPKWSSKDLATVVPNLEKTG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G544120`
TK1151 ID	TkA03G544120
OH-1004 ID	LXL04_010696
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 90.462 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G544120`
Location	Chr03:137211692-137214794 (-)
Description	Similar to CDC2A: Cell division control protein 2 homolog A
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010696` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000082 G1/S transition of mitotic cell cycle Biological Process GO:0007165 signal transduction Biological Process GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process GO:0010468 regulation of gene expression Biological Process GO:0051301 cell division Biological Process GO:0051445 regulation of meiotic cell cycle Biological Process GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0004693 cyclin-dependent protein serine/threonine kinase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0008353 RNA polymerase II CTD heptapeptide repeat kinase activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.665

Rank 1 · TkA03G544120 · TK1151

Cytoplasm0.544

Rank 2 · TkA03G544120 · TK1151

Cell membrane0.048

Rank 3 · TkA03G544120 · TK1151

Mitochondrion0.042

Rank 4 · TkA03G544120 · TK1151

Endoplasmic reticulum0.025

Rank 5 · TkA03G544120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase4-287 aa

PF07714PK_Tyr_Ser-Thr6-199 aa

PF14531Kinase-like6-40 aa

PF12330Haspin_kinase11-153 aa

PF03109ABC113-36 aa

PF06293Kdo49-141 aa

PF03109ABC178-159 aa

PF14531Kinase-like109-150 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G544120	`PF00069`	Pkinase	4	287	1.4e-78	264.6
TkA03G544120	`PF07714`	PK_Tyr_Ser-Thr	6	199	2.3e-32	113.1
TkA03G544120	`PF14531`	Kinase-like	6	40	0.079	12.9
TkA03G544120	`PF12330`	Haspin_kinase	11	153	0.0029	17.4
TkA03G544120	`PF03109`	ABC1	13	36	0.0012	18.8
TkA03G544120	`PF06293`	Kdo	49	141	0.05	13.8
TkA03G544120	`PF03109`	ABC1	78	159	0.0012	18.8
TkA03G544120	`PF14531`	Kinase-like	109	150	0.079	12.9
TkA03G544120	`PF12330`	Haspin_kinase	200	228	0.0029	17.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card