TkA03G538050 | RubberDandelionOmics

Gene overview

TkA03G538050

Reference: TK1151 Chr: Chr03 Coordinates: 135462730-135463887 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1122 bp · TkA03G538050|TK1151|cDNA

ATGGTGCGCAGAAAATCAATGAAGGTTGACGATAAAGCAAAAGAATCGCTCAACATCGATGATCGGATAACCCGTTTACCCAATGATGTTATTCATCAAATATATTCATATCTGGATTCTAGATATTGTGTTCAAAGTAGCCTTCTCTCGCGTACTTGGAGAAATACTTGGAAATCCCATCCACATTTGAAATTCGAAACCGATCCCTACACCACTAGTCGTGATCAAAACGCAGAAATATCCACCATTGACTTCCGGTC...

CDS

Download CDS FASTA

1122 bp · TkA03G538050|TK1151|CDS

ATGGTGCGCAGAAAATCAATGAAGGTTGACGATAAAGCAAAAGAATCGCTCAACATCGATGATCGGATAACCCGTTTACCCAATGATGTTATTCATCAAATATATTCATATCTGGATTCTAGATATTGTGTTCAAAGTAGCCTTCTCTCGCGTACTTGGAGAAATACTTGGAAATCCCATCCACATTTGAAATTCGAAACCGATCCCTACACCACTAGTCGTGATCAAAACGCAGAAATATCCACCATTGACTTCCGGTC...

Protein

Download Protein FASTA

373 aa · TkA03G538050|TK1151|PROTEIN

MVRRKSMKVDDKAKESLNIDDRITRLPNDVIHQIYSYLDSRYCVQSSLLSRTWRNTWKSHPHLKFETDPYTTSRDQNAEISTIDFRSKSIPLRLLKEIVTYAISHNTQKLNIEYLNGIPTRRGCLETSLFKSHFLQCLYLNIDFELEKPPNLTWDLPSLNTLHLEKVTFTTYPLNNDGKKSLDLFSNFSKLKTLVLLNCRVWDIKIFYITSTGLENLTINFLHHSCEFVISAPKLSSFTYDRMSPSLLSANDLESLETVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G538050`
TK1151 ID	TkA03G538050
OH-1004 ID	LXL04_010626
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.800
Protein coverage (%)	TK1151 100.000 / OH-1004 67.901 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G538050

Location Chr03:135462730-135463887 (+)

Description Similar to At4g00160: F-box/FBD/LRR-repeat protein At4g00160

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03360`	F-box/LRR-repeat protein At3g03360.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010626 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT3G26922

ath:AT3G52680

ath:AT4G00160

ath:AT5G56420

ath:AT5G56440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.799

Rank 1 · TkA03G538050 · TK1151

Cytoplasm0.246

Rank 2 · TkA03G538050 · TK1151

Cell membrane0.046

Rank 3 · TkA03G538050 · TK1151

Endoplasmic reticulum0.039

Rank 4 · TkA03G538050 · TK1151

Plastid0.015

Rank 5 · TkA03G538050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15966F-box_421-56 aa

PF00646F-box23-62 aa

PF12937F-box-like24-54 aa

PF00646F-box90-100 aa

PF23622LRR_At1g61320_AtMIF1156-261 aa

PF07723LRR_2158-169 aa

PF07723LRR_2190-203 aa

PF07723LRR_2318-325 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G538050	`PF15966`	F-box_4	21	56	0.021	15.4
TkA03G538050	`PF00646`	F-box	23	62	3.3e-08	33.8
TkA03G538050	`PF12937`	F-box-like	24	54	7.2e-05	23.2
TkA03G538050	`PF00646`	F-box	90	100	3.3e-08	33.8
TkA03G538050	`PF23622`	LRR_At1g61320_AtMIF1	156	261	0.0036	17.4
TkA03G538050	`PF07723`	LRR_2	158	169	0.64	11.5
TkA03G538050	`PF07723`	LRR_2	190	203	0.64	11.5
TkA03G538050	`PF07723`	LRR_2	318	325	0.64	11.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84W80`	Arabidopsis thaliana	sp\|Q84W80\|FBL42_ARATH F-box/LRR-repeat protein At3g03360	25.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card