TkA03G537750 | RubberDandelionOmics

Gene overview

TkA03G537750

Reference: TK1151 Chr: Chr03 Coordinates: 135386298-135387428 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1095 bp · TkA03G537750|TK1151|cDNA

ATGAGGAGGAGGAAATCAATGAGGGTTACAGAGAGGGCTAAGGAAATGATAAATGACGATGATCGAATAAGCCGTTTGCCTGATGGTGTAATCCATCACATCTATTCGTTCATAGATACAAGATTTGCAGTTCAAAGCAGTATTCTATCAAGAAGATGGAGAAACACTTGGAAATCACAACCATGTCTCGACTTCCAAATCAACCGCCCAATCGGCGATCGCGATCACAGTTCCGAACTTACCACAATTGACTTCCGATC...

CDS

Download CDS FASTA

1095 bp · TkA03G537750|TK1151|CDS

ATGAGGAGGAGGAAATCAATGAGGGTTACAGAGAGGGCTAAGGAAATGATAAATGACGATGATCGAATAAGCCGTTTGCCTGATGGTGTAATCCATCACATCTATTCGTTCATAGATACAAGATTTGCAGTTCAAAGCAGTATTCTATCAAGAAGATGGAGAAACACTTGGAAATCACAACCATGTCTCGACTTCCAAATCAACCGCCCAATCGGCGATCGCGATCACAGTTCCGAACTTACCACAATTGACTTCCGATC...

Protein

Download Protein FASTA

364 aa · TkA03G537750|TK1151|PROTEIN

MRRRKSMRVTERAKEMINDDDRISRLPDGVIHHIYSFIDTRFAVQSSILSRRWRNTWKSQPCLDFQINRPIGDRDHSSELTTIDFRSNSIKLALLKEVIMYAMSHYTKKINIEFLGEKTRRGGFDLSLFRSRFLQDLRLSIDFELLKTPYLTWDLPALTSLTLENVTFTLRPPNNKSMDLFSRFPNLKTLVLVDCRLSFIDKFIITSSGLINLSLIDLNHTSEFIISTPKLVSFTYYGMARFQLSAKDLDSLQTVNFHTI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G537750`
TK1151 ID	TkA03G537750
OH-1004 ID	LXL04_010626
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	52.800
Protein coverage (%)	TK1151 98.901 / OH-1004 66.138 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G537750

Location Chr03:135386298-135387428 (+)

Description Similar to At4g00160: F-box/FBD/LRR-repeat protein At4g00160

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g49610`	Putative F-box protein At1g49610.	No verified direct reference in this release
`At3g18150`	Putative F-box/LRR-repeat protein At3g18150.	No verified direct reference in this release
`At3g59000`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g03360`	F-box/LRR-repeat protein At3g03360.	No verified direct reference in this release
`At4g13960`	Putative F-box/LRR-repeat protein At4g13960.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010626 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT3G26922

ath:AT3G52680

ath:AT4G00160

ath:AT5G56420

ath:AT5G56440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.851

Rank 1 · TkA03G537750 · TK1151

Cytoplasm0.191

Rank 2 · TkA03G537750 · TK1151

Cell membrane0.038

Rank 3 · TkA03G537750 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA03G537750 · TK1151

Plastid0.017

Rank 5 · TkA03G537750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box23-62 aa

PF12937F-box-like23-54 aa

PF13855LRR_878-91 aa

PF12799LRR_479-91 aa

PF23622LRR_At1g61320_AtMIF195-275 aa

PF12799LRR_4136-165 aa

PF13855LRR_8153-165 aa

PF12799LRR_4185-221 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G537750	`PF00646`	F-box	23	62	9.9e-07	29.2
TkA03G537750	`PF12937`	F-box-like	23	54	0.042	14.3
TkA03G537750	`PF13855`	LRR_8	78	91	0.16	12.5
TkA03G537750	`PF12799`	LRR_4	79	91	0.022	15.8
TkA03G537750	`PF23622`	LRR_At1g61320_AtMIF1	95	275	0.0094	16.1
TkA03G537750	`PF12799`	LRR_4	136	165	0.022	15.8
TkA03G537750	`PF13855`	LRR_8	153	165	0.16	12.5
TkA03G537750	`PF12799`	LRR_4	185	221	0.022	15.8
TkA03G537750	`PF13855`	LRR_8	185	221	0.16	12.5
TkA03G537750	`PF12937`	F-box-like	244	255	0.042	14.3
TkA03G537750	`PF12799`	LRR_4	247	257	0.022	15.8
TkA03G537750	`PF12799`	LRR_4	269	284	0.022	15.8
TkA03G537750	`PF12799`	LRR_4	313	319	0.022	15.8
TkA03G537750	`PF13855`	LRR_8	313	318	0.16	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FX89`	Arabidopsis thaliana	sp\|Q9FX89\|FB50_ARATH Putative F-box protein At1g49610	30.900%	Swiss-Prot	Low
`Q9LV26`	Arabidopsis thaliana	sp\|Q9LV26\|FBL45_ARATH Putative F-box/LRR-repeat protein At3g18150	29.000%	Swiss-Prot	Low
`Q2V3N5`	Arabidopsis thaliana	sp\|Q2V3N5\|FB211_ARATH F-box protein At3g59000	23.700%	Swiss-Prot	Low
`Q84W80`	Arabidopsis thaliana	sp\|Q84W80\|FBL42_ARATH F-box/LRR-repeat protein At3g03360	48.000%	Swiss-Prot	Low
`O23257`	Arabidopsis thaliana	sp\|O23257\|FBL72_ARATH Putative F-box/LRR-repeat protein At4g13960	24.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card