TkA03G535340 | RubberDandelionOmics

Gene overview

TkA03G535340

Reference: TK1151 Chr: Chr03 Coordinates: 134713196-134717586 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2914 bp · TkA03G535340|TK1151|cDNA

AGAAAAACAAACAAATAAATAAATCCTCCTTTTTGTTAGTTGAAGACACATACACACACACACACTGTGTACTCTGCCACTCTCTTTTCTCTTTCTAAAGTGCTCAAATCAGGCGCCAGTTAGCTTGAGAAACATCGCGACACCGCCGGCGGCGAAAATAGAGCTATTCCGACATGGGTTGTACAGCCTCAAAGTTAGGCAACGAGGATTCAGTCCGCCGGTGCAAGGAACGCCGACGTCTCATGAAAGAAGCCGTCTAC...

CDS

Download CDS FASTA

2505 bp · TkA03G535340|TK1151|CDS

ATGGGTTGTACAGCCTCAAAGTTAGGCAACGAGGATTCAGTCCGCCGGTGCAAGGAACGCCGACGTCTCATGAAAGAAGCCGTCTACGCCCGCCACCACCTCGCCGCTGCCCACTCTGACTACTGCCGTTCCCTAAAAATCACCGGATCCGCACTCGCTAACTTCGCAGCTGGGGAACCCCTCTCCGTCGCTGATCAAACACCTGCGGTTCTCCTCCCCACTCGTTCCTCATCCTCCACTCCGACCACCGTCAAACCCCC...

Protein

Download Protein FASTA

834 aa · TkA03G535340|TK1151|PROTEIN

MGCTASKLGNEDSVRRCKERRRLMKEAVYARHHLAAAHSDYCRSLKITGSALANFAAGEPLSVADQTPAVLLPTRSSSSTPTTVKPPSFHSYETPTPSPPVPRSPSVASSKLPPILSAAPSRAGTASLHNHQRRHKPSVKLPHILSESSEASASPRENPQNNFSYNPDKYTYNAQANYASTPSQASSVWNWENFYPPSPPDSEYFNQRQPNFDTEDDKSSIYSSKASVYSGYKEQRHRENNEDKGSVYSTYSQKTHHHHP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G535340`
TK1151 ID	TkA03G535340
OH-1004 ID	LXL04_010550
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G535340

Location Chr03:134713196-134717586 (+)

Description Similar to NRG2: Nitrate regulatory gene2 protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60320`	Required for nitrate signaling.	The Arabidopsis NRG2 Protein Mediates Nitrate Signaling and Interacts with and Regulates Key Nitrate Regulators.2016 · DOI: 10.1105/tpc.15.00567
`At3g51290`	Required for the coordination of cell differentiation and cell elongation in the root tip.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0562700`	Involved in the regulation of leaf shape formation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010550 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010167 response to nitrate Biological Process

GO:0015706 nitrate transmembrane transport Biological Process

GO:0030154 cell differentiation Biological Process

GO:0071249 cellular response to nitrate Biological Process

GO:0071705 nitrogen compound transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G51290

ath:AT3G60320

dosa:Os10g0562700

osa:4349394

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.544

Rank 1 · TkA03G535340 · TK1151

Cytoplasm0.322

Rank 2 · TkA03G535340 · TK1151

Nucleus0.269

Rank 3 · TkA03G535340 · TK1151

Endoplasmic reticulum0.045

Rank 4 · TkA03G535340 · TK1151

Golgi apparatus0.042

Rank 5 · TkA03G535340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04783DUF6301-59 aa

PF04782DUF632265-304 aa

PF04782DUF632391-699 aa

PF04048Sec8_N395-437 aa

PF26308YopA_M600-641 aa

PF04048Sec8_N601-630 aa

PF10364NKWYS631-724 aa

PF26308YopA_M653-706 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G535340	`PF04783`	DUF630	1	59	1.1e-24	87.1
TkA03G535340	`PF04782`	DUF632	265	304	2.2e-104	349.9
TkA03G535340	`PF04782`	DUF632	391	699	2.2e-104	349.9
TkA03G535340	`PF04048`	Sec8_N	395	437	3.8	8.1
TkA03G535340	`PF26308`	YopA_M	600	641	0.098	13.1
TkA03G535340	`PF04048`	Sec8_N	601	630	3.8	8.1
TkA03G535340	`PF10364`	NKWYS	631	724	0.15	12.9
TkA03G535340	`PF26308`	YopA_M	653	706	0.098	13.1
TkA03G535340	`PF04048`	Sec8_N	689	740	3.8	8.1
TkA03G535340	`PF04782`	DUF632	713	737	2.2e-104	349.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YU8`	Arabidopsis thaliana	sp\|Q93YU8\|NRG2_ARATH Nitrate regulatory gene2 protein	61.500%	Swiss-Prot	High
`A0A178VBJ0`	Arabidopsis thaliana	sp\|A0A178VBJ0\|APSR1_ARATH Protein ALTERED PHOSPHATE STARVATION RESPONSE 1	43.400%	Swiss-Prot	Medium
`Q9AQW1`	Oryza sativa subsp. japonica	sp\|Q9AQW1\|REL2_ORYSJ Protein ROLLING AND ERECT LEAF 2	51.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card