TkA03G533890 | RubberDandelionOmics

Gene overview

TkA03G533890

Reference: TK1151 Chr: Chr03 Coordinates: 134267323-134273752 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3126 bp · TkA03G533890|TK1151|cDNA

CTTCCATTGACTTCTCATACTTTCAAAAACTATATAAACTTGTCTTCTCCACTCTCCTATTCACCACACTTCAGTTTCCATAACCCAAAATGAGTACCAATAACTTTTCTGCTATTTTTAGCTTGATATCATTATTTTTCACTTTTGTTCCTTTAATCTCAGCCGTTGGATCCCCGATCAACATATGGCCCAAACCAAGATCCTTCATCTGGACCACTCCACAGGCAATCCCTTTATCACCATCTTTCACCATTACTTCC...

CDS

Download CDS FASTA

1725 bp · TkA03G533890|TK1151|CDS

ATGAGTACCAATAACTTTTCTGCTATTTTTAGCTTGATATCATTATTTTTCACTTTTGTTCCTTTAATCTCAGCCGTTGGATCCCCGATCAACATATGGCCCAAACCAAGATCCTTCATCTGGACCACTCCACAGGCAATCCCTTTATCACCATCTTTCACCATTACTTCCCCGCCGCACCCCTACCTAACTCCGGCCATTAACCGTTACATCCGCCAAATCCAAGCCGCTAACTACAGCCCCTTACTTGCTCCGGCGAT...

Protein

Download Protein FASTA

574 aa · TkA03G533890|TK1151|PROTEIN

MSTNNFSAIFSLISLFFTFVPLISAVGSPINIWPKPRSFIWTTPQAIPLSPSFTITSPPHPYLTPAINRYIRQIQAANYSPLLAPAINFTTALPLQTLTITVSDLTATLSHGVNESYTLSIPSNKNSATLTAATPWGAMRGLESFSQLVWGNPARVAVGLVISDWPIFEHRGILLDTSRNYYGVEDLLRLIGAMSANKLNLFHWHITDSHSFPLVLKSEPELAGKGSYGSDMQYSTEDVKRIVQFGLEHGVRVIPEIDMP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G533890`
TK1151 ID	TkA03G533890
OH-1004 ID	LXL04_010527
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.100
Protein coverage (%)	TK1151 98.780 / OH-1004 50.177 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G533890

Location Chr03:134267323-134273752 (+)

Description Similar to HEXO2: Beta-hexosaminidase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05590`	Has a broad substrate specificity.	Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.2007 · DOI: 10.1074/jbc.m704235200 Enzymatic properties and subcellular localization of Arabidopsis beta-N-acetylhexosaminidases.2007 · DOI: 10.1104/pp.107.101162

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010527 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0030203 glycosaminoglycan metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004563 beta-N-acetylhexosaminidase activity Molecular Function

GO:0015929 hexosaminidase activity Molecular Function

GO:0016231 beta-N-acetylglucosaminidase activity Molecular Function

GO:0035251 UDP-glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G05590

cpw:9696864

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.538

Rank 1 · TkA03G533890 · TK1151

Lysosome / Vacuole0.162

Rank 2 · TkA03G533890 · TK1151

Cytoplasm0.068

Rank 3 · TkA03G533890 · TK1151

Endoplasmic reticulum0.062

Rank 4 · TkA03G533890 · TK1151

Cell membrane0.057

Rank 5 · TkA03G533890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02838Glyco_hydro_20b30-165 aa

PF14845Glycohydro_20b232-148 aa

PF00728Glyco_hydro_20168-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G533890	`PF02838`	Glyco_hydro_20b	30	165	0.00039	21.9
TkA03G533890	`PF14845`	Glycohydro_20b2	32	148	5.7e-22	79.6
TkA03G533890	`PF00728`	Glyco_hydro_20	168	522	1.3e-101	341.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYK0`	Arabidopsis thaliana	sp\|Q9SYK0\|HEXO2_ARATH Beta-hexosaminidase 2	63.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card