TkA03G526170 | RubberDandelionOmics

Gene overview

TkA03G526170

Reference: TK1151 Chr: Chr03 Coordinates: 132091534-132093916 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1802 bp · TkA03G526170|TK1151|cDNA

CTACCACACTCTATTAAATCTCCGTCGTCAAAATTCTCCAAAAATAGCCGCCTCTCTCGCAACCCCAAAAGCTACTCCCTTTCTTGCCATCGCCTTTGTCTTTGCCTTCTCATTTTCCCCAAAAGCTTCCCAAGCACCACCACACTTCCAATTCAATCACAATTTCTCTTGATCATCAACACTATATATATACAGAATTAATGTGCATTCTGGCCATTTGTTTTCATCTCTATAAACACTCATGGCTCTCGTGAGCAAAC...

CDS

Download CDS FASTA

1140 bp · TkA03G526170|TK1151|CDS

ATGGCTCTCGTGAGCAAACTTCCTTCATCTTCATCTTCATCTTCATCTTCATCTTCGTCGTCGTCTTCACTAACCCAATTCAGAAAACCCCTATTTTCCACTCTGAGACCCGCCAGTTCCGTACATTTTACAAAAACATCTTGTTCAGCCTCGCCTTTCACTGAAAAACATTCAATTGAGAGATACCAAAGGGACAAATGGGTGTTCAAGAACCAATTAGATCAAACCCCACCTGAAAATCACCCCAATTTCACAACTAG...

Protein

Download Protein FASTA

379 aa · TkA03G526170|TK1151|PROTEIN

MALVSKLPSSSSSSSSSSSSSSSLTQFRKPLFSTLRPASSVHFTKTSCSASPFTEKHSIERYQRDKWVFKNQLDQTPPENHPNFTTRDYEIALQLPELKNLLQVLREKREKGGDGESGKGGPGNVFLVGTGPGDPELLTLKALKVIQNADLLLYDRLVSNDVLEMVRPDARLLYVGKTAGYHSRTQEEIHELLLSFAEVGANVVRLKGGDPLVFGRGGEEMDFLQQQGIQVKVIPGITAASGIAAELGVPLTHRGVANSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G526170`
TK1151 ID	TkA03G526170
OH-1004 ID	LXL04_010414
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G526170

Location Chr03:132091534-132093916 (+)

Description Similar to cysG: Siroheme synthase (Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g40850`	Essential protein required for siroheme biosynthesis.	Alleviation of Nitrogen and Sulfur Deficiency and Enhancement of Photosynthesis in Arabidopsis thaliana by Overexpression of Uroporphyrinogen III Methyltransferase ( UPM1 ).2017 · DOI: 10.3389/fpls.2017.02265 Siroheme biosynthesis in higher plants. Analysis of an S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase from Arabidopsis thaliana.1997 · DOI: 10.1074/jbc.272.5.2744

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010414 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0019354 siroheme biosynthetic process Biological Process

GO:0032259 methylation Biological Process

GO:0090352 regulation of nitrate assimilation Biological Process

GO:1900058 regulation of sulfate assimilation Biological Process

GO:1902326 positive regulation of chlorophyll biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0004851 uroporphyrin-III C-methyltransferase activity Molecular Function

GO:0043115 precorrin-2 dehydrogenase activity Molecular Function

GO:0051266 sirohydrochlorin ferrochelatase activity Molecular Function

GO:0051287 NAD binding Molecular Function

KEGG gene cross-reference

aci:ACIAD2934

ath:AT5G40850

avn:Avin_28170

sde:Sde_1698

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.915

Rank 1 · TkA03G526170 · TK1151

Mitochondrion0.126

Rank 2 · TkA03G526170 · TK1151

Cytoplasm0.029

Rank 3 · TkA03G526170 · TK1151

Nucleus0.026

Rank 4 · TkA03G526170 · TK1151

Cell membrane0.011

Rank 5 · TkA03G526170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00590TP_methylase125-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G526170	`PF00590`	TP_methylase	125	336	1.5e-51	176.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42606`	Arabidopsis thaliana	sp\|Q42606\|UPM1_ARATH S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase, chloroplastic	67.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card