TkA03G516790 | RubberDandelionOmics

Gene overview

TkA03G516790

Reference: TK1151 Chr: Chr03 Coordinates: 129663507-129664921 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

942 bp · TkA03G516790|TK1151|cDNA

ATGGAGGAGTCTAATCCTGATTACGATTACTTGTACAAGCTTGTTTTGAATGGGGATCTTGGTGTCGGTAAAACCAATCTTTTCTCGCGATTCACGAGCGACAAATTCAGCCTCGAATCCAAATCCACAATCGGGGTTGAATTCGCCACCCGTCTCATCAATGTCGATGGCAAGATCATTAAAGCCCAAATTTGGGACACCGCGGAAACATTCGAACACGTTGAAAGATGGTTGAAGGAGCTTCGGGATTGCTCGGATCC...

CDS

Download CDS FASTA

942 bp · TkA03G516790|TK1151|CDS

ATGGAGGAGTCTAATCCTGATTACGATTACTTGTACAAGCTTGTTTTGAATGGGGATCTTGGTGTCGGTAAAACCAATCTTTTCTCGCGATTCACGAGCGACAAATTCAGCCTCGAATCCAAATCCACAATCGGGGTTGAATTCGCCACCCGTCTCATCAATGTCGATGGCAAGATCATTAAAGCCCAAATTTGGGACACCGCGGAAACATTCGAACACGTTGAAAGATGGTTGAAGGAGCTTCGGGATTGCTCGGATCC...

Protein

Download Protein FASTA

313 aa · TkA03G516790|TK1151|PROTEIN

MEESNPDYDYLYKLVLNGDLGVGKTNLFSRFTSDKFSLESKSTIGVEFATRLINVDGKIIKAQIWDTAETFEHVERWLKELRDCSDPNIVVMLVGNKADQINSRSVRTEDAKEFADRNNIKFFMETSALNTFNVDSAFTKLLTQIHHFSNIKTLDKDNAHMVERKDFVIACRRYSQDDGSIVEPPRFSSDNFSVWKNPKDMWDNLILIFEGADELHKAILGYEYECFTYKPGESLTDTYIRFKCVVNDMRQHGETFNNDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G516790`
TK1151 ID	TkA03G516790
OH-1004 ID	LXL04_010225
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	42.200
Protein coverage (%)	TK1151 95.527 / OH-1004 84.008 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G516790

Location Chr03:129663507-129664921 (+)

Description Similar to RABA1F: Ras-related protein RABA1f

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15060`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At5g60860`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At5g45750`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At4g18430`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At4g18800`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010225 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0005768 endosome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

KEGG gene cross-reference

ath:AT1G28550

ath:AT2G33870

ath:AT3G15060

ath:AT5G60860

nta:107770722

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.629

Rank 1 · TkA03G516790 · TK1151

Nucleus0.316

Rank 2 · TkA03G516790 · TK1151

Cell membrane0.084

Rank 3 · TkA03G516790 · TK1151

Endoplasmic reticulum0.075

Rank 4 · TkA03G516790 · TK1151

Mitochondrion0.051

Rank 5 · TkA03G516790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00071Ras13-68 aa

PF08477Roc13-68 aa

PF10662PduV-EutP13-67 aa

PF02492cobW14-63 aa

PF02367TsaE14-31 aa

PF09439SRPRB14-51 aa

PF01926MMR_HSR115-102 aa

PF09439SRPRB55-105 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G516790	`PF00071`	Ras	13	68	4.3e-36	124.6
TkA03G516790	`PF08477`	Roc	13	68	2.1e-16	60.9
TkA03G516790	`PF10662`	PduV-EutP	13	67	0.051	14.1
TkA03G516790	`PF02492`	cobW	14	63	0.13	12.6
TkA03G516790	`PF02367`	TsaE	14	31	0.16	12.7
TkA03G516790	`PF09439`	SRPRB	14	51	0.25	11.4
TkA03G516790	`PF01926`	MMR_HSR1	15	102	0.21	12.4
TkA03G516790	`PF09439`	SRPRB	55	105	0.25	11.4
TkA03G516790	`PF00071`	Ras	68	146	4.3e-36	124.6
TkA03G516790	`PF08477`	Roc	69	99	2.1e-16	60.9
TkA03G516790	`PF02492`	cobW	92	116	0.13	12.6
TkA03G516790	`PF09439`	SRPRB	132	173	0.25	11.4
TkA03G516790	`PF14223`	Retrotran_gag_2	198	302	5.7e-15	56.2
TkA03G516790	`PF24951`	LisH_PAC1	212	222	0.045	14.2
TkA03G516790	`PF24951`	LisH_PAC1	293	306	0.045	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK99`	Arabidopsis thaliana	sp\|Q9LK99\|RAA1G_ARATH Ras-related protein RABA1g	56.200%	Swiss-Prot	Medium
`Q9FJH0`	Arabidopsis thaliana	sp\|Q9FJH0\|RAA1F_ARATH Ras-related protein RABA1f	56.700%	Swiss-Prot	Low
`Q9FK68`	Arabidopsis thaliana	sp\|Q9FK68\|RAA1C_ARATH Ras-related protein RABA1c	54.400%	Swiss-Prot	Low
`O49513`	Arabidopsis thaliana	sp\|O49513\|RAA1E_ARATH Ras-related protein RABA1e	55.600%	Swiss-Prot	Low
`Q9SN35`	Arabidopsis thaliana	sp\|Q9SN35\|RAA1D_ARATH Ras-related protein RABA1d	54.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card