TkA03G516630 | RubberDandelionOmics

Gene overview

TkA03G516630

Reference: TK1151 Chr: Chr03 Coordinates: 129630141-129640246 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

750 bp · TkA03G516630|TK1151|cDNA

ATGCTTGTGGGGAACAAATCGGATACTAAATACCGACATGTCCAAATGGAAGATGCAAAAGCATTTGCCGAGAGAGAGAAGATTAAATTATTCATGGAAACATCGGCTCTCAATATGTCAAATGTGAATAACTGTTTCACCAAAATGCTGACTCAGATTTACCATATACATCCGTATGTATGTATTACTAATGAAAAATGTAATGGGTTAATTAAGTTGCAGGGTTTTGTTACGGCATCGAGAAGACATTCACAAGATCA...

CDS

Download CDS FASTA

750 bp · TkA03G516630|TK1151|CDS

ATGCTTGTGGGGAACAAATCGGATACTAAATACCGACATGTCCAAATGGAAGATGCAAAAGCATTTGCCGAGAGAGAGAAGATTAAATTATTCATGGAAACATCGGCTCTCAATATGTCAAATGTGAATAACTGTTTCACCAAAATGCTGACTCAGATTTACCATATACATCCGTATGTATGTATTACTAATGAAAAATGTAATGGGTTAATTAAGTTGCAGGGTTTTGTTACGGCATCGAGAAGACATTCACAAGATCA...

Protein

Download Protein FASTA

249 aa · TkA03G516630|TK1151|PROTEIN

MLVGNKSDTKYRHVQMEDAKAFAEREKIKLFMETSALNMSNVNNCFTKMLTQIYHIHPYVCITNEKCNGLIKLQGFVTASRRHSQDHNGLRTNIEPPKLSSDNFTIWKHRMISYLNLVDINEDIRESRRSVVIQQYELFTCNPGESLTESFIRFKCLVNEMMRHQCKTFDNEEMVNKFLESLPMEWKSMAIMIRQMGDLKSMSLEGLYGHLMTHKLETEHDAWMKVEELCSQRGQFGRNIKQKVAIDNN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G516630`
TK1151 ID	TkA03G516630
OH-1004 ID	LXL04_010279
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	56.800
Protein coverage (%)	TK1151 68.273 / OH-1004 87.407 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G516630

Location Chr03:129630141-129640246 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18800`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At5g45750`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0551400`	Possesses GTPase activity.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010279 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.547

Rank 1 · TkA03G516630 · TK1151

Nucleus0.370

Rank 2 · TkA03G516630 · TK1151

Endoplasmic reticulum0.071

Rank 3 · TkA03G516630 · TK1151

Mitochondrion0.067

Rank 4 · TkA03G516630 · TK1151

Cell membrane0.067

Rank 5 · TkA03G516630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00071Ras1-54 aa

PF08953DUF18999-46 aa

PF13961DUF421926-34 aa

PF14244Retrotran_gag_383-116 aa

PF13961DUF421999-115 aa

PF14223Retrotran_gag_2125-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G516630	`PF00071`	Ras	1	54	5.1e-10	39.9
TkA03G516630	`PF08953`	DUF1899	9	46	0.14	12.8
TkA03G516630	`PF13961`	DUF4219	26	34	0.0072	16.8
TkA03G516630	`PF14244`	Retrotran_gag_3	83	116	0.23	12.0
TkA03G516630	`PF13961`	DUF4219	99	115	0.0072	16.8
TkA03G516630	`PF14223`	Retrotran_gag_2	125	214	4.2e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SN35`	Arabidopsis thaliana	sp\|Q9SN35\|RAA1D_ARATH Ras-related protein RABA1d	61.400%	Swiss-Prot	Low
`Q9FK68`	Arabidopsis thaliana	sp\|Q9FK68\|RAA1C_ARATH Ras-related protein RABA1c	61.400%	Swiss-Prot	Low
`P40393`	Oryza sativa subsp. japonica	sp\|P40393\|RIC2_ORYSJ Ras-related protein RIC2	59.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card