TkA03G509700 | RubberDandelionOmics

Gene overview

TkA03G509700

Reference: TK1151 Chr: Chr03 Coordinates: 127808597-127812412 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2280 bp · TkA03G509700|TK1151|cDNA

ATATCCAAGGCCAGATCCACCCACGTGAGTTCAAATTATGGAAAGCAAAATAATTCAAATTATGGAAAGAAAAATAAGGCTAACAGTTTCGGAAGTTTTGAGCATGAAAAAAGGCCCACAAATTGCCAAACTCCACTTAGCCCATCTCAAGTATTCAAAGTGGCTGAAAATTACGAAACTCAGGCGCACGTGATTCCCATTGTTACCAGCCCCACAAGCAAAATTAATACCTCAAGTGTTTTGCCAGACCCCACCATTTC...

CDS

Download CDS FASTA

2280 bp · TkA03G509700|TK1151|CDS

ATATCCAAGGCCAGATCCACCCACGTGAGTTCAAATTATGGAAAGCAAAATAATTCAAATTATGGAAAGAAAAATAAGGCTAACAGTTTCGGAAGTTTTGAGCATGAAAAAAGGCCCACAAATTGCCAAACTCCACTTAGCCCATCTCAAGTATTCAAAGTGGCTGAAAATTACGAAACTCAGGCGCACGTGATTCCCATTGTTACCAGCCCCACAAGCAAAATTAATACCTCAAGTGTTTTGCCAGACCCCACCATTTC...

Protein

Download Protein FASTA

759 aa · TkA03G509700|TK1151|PROTEIN

ISKARSTHVSSNYGKQNNSNYGKKNKANSFGSFEHEKRPTNCQTPLSPSQVFKVAENYETQAHVIPIVTSPTSKINTSSVLPDPTISLTAYQDDFLAEQSEKNIETEEGKIDDSTIVWEKKASRLKKLKRDLKMRKIKSPCKCRVKIKRNGDGCKHAILSGDVISKPIIIEREKEDSSDSEVFIMSSNNRNFKKEENFPAAKKHEDRITEEVSKLDDETKSDKLGDFDANALWGSNKNSWAASHSIGNSGGVISIWDPAY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G509700`
TK1151 ID	TkA03G509700
OH-1004 ID	LXL04_000694
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	38.200
Protein coverage (%)	TK1151 74.572 / OH-1004 51.691 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G509700`
Location	Chr03:127808597-127812412 (-)
Description	Similar to LBD13: LOB domain-containing protein 13
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000694` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009965 leaf morphogenesis Biological Process GO:0010016 shoot system morphogenesis Biological Process GO:0010311 lateral root formation Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:1905177 tracheary element differentiation Biological Process GO:0005634 nucleus Cellular Component GO:0000976 transcription cis-regulatory region binding Molecular Function GO:0001216 DNA-binding transcription activator activity Molecular Function GO:0003677 DNA binding Molecular Function GO:0003824 catalytic activity Molecular Function
KEGG gene cross-reference	ath:AT2G30130 ath:AT2G30340 ath:AT2G40470 ath:AT3G27650 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.530

Rank 1 · TkA03G509700 · TK1151

Nucleus0.346

Rank 2 · TkA03G509700 · TK1151

Cell membrane0.123

Rank 3 · TkA03G509700 · TK1151

Plastid0.063

Rank 4 · TkA03G509700 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA03G509700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03665UPF017221-133 aa

PF03665UPF0172177-229 aa

PF14529Exo_endo_phos_2221-239 aa

PF14529Exo_endo_phos_2288-410 aa

PF03372Exo_endo_phos292-407 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G509700	`PF03665`	UPF0172	21	133	3.6	8.2
TkA03G509700	`PF03665`	UPF0172	177	229	3.6	8.2
TkA03G509700	`PF14529`	Exo_endo_phos_2	221	239	1.5e-09	38.5
TkA03G509700	`PF14529`	Exo_endo_phos_2	288	410	1.5e-09	38.5
TkA03G509700	`PF03372`	Exo_endo_phos	292	407	1.6e-05	25.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card