TkA03G507670 | RubberDandelionOmics

Gene overview

TkA03G507670

Reference: TK1151 Chr: Chr03 Coordinates: 127234226-127237942 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1761 bp · TkA03G507670|TK1151|cDNA

CTAAAATGTTGACTCCCGATCCTCTTCTGATAAATTCTACGACGCCCGACGTCTTCATTGTCAACTCCCGCACGCTACCTTCATTCCCTTCGCAACTACCAAACTCTGATCGACGATGGAACAACAACATATAGTCTCCGATGACGTACTCGTCAGCGGTGGCAAAACATCACTGACGCTCTCTGTTGACGGGATACTCCAATGGTCAGATGGAGGCTTAATTCACCGGTGCTTGTCTGTAGAGAAGGAAGTTCTTGGAT...

CDS

Download CDS FASTA

1422 bp · TkA03G507670|TK1151|CDS

ATGGAACAACAACATATAGTCTCCGATGACGTACTCGTCAGCGGTGGCAAAACATCACTGACGCTCTCTGTTGACGGGATACTCCAATGGTCAGATGGAGGCTTAATTCACCGGTGCTTGTCTGTAGAGAAGGAAGTTCTTGGATTTTCAAAGGTTGGACGCCTGATCACAATTAGGGCACTTGTTCCAACAGGTGGTGATCGATTTTGCTTCGGAAGTAGTGGCGACGGGAGTTTGACGAGGAAGAGCTTCTTATTTGA...

Protein

Download Protein FASTA

473 aa · TkA03G507670|TK1151|PROTEIN

MEQQHIVSDDVLVSGGKTSLTLSVDGILQWSDGGLIHRCLSVEKEVLGFSKVGRLITIRALVPTGGDRFCFGSSGDGSLTRKSFLFEAVNENSLRNLCEKIQAYIDSLGRPKKLFIFVNPFGGRKSASKIFTNDVKPILEDANIDYTLQETRYQLHAKELSRSLDLTKYDGIICVSGDGILVEVVNGLLEREDWAIALKIPLGVIPAGTGNGMIKSLLDSVGQPCTPLHATLAAVRGHKRCLDVATIWQGETAFFSVLML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G507670`
TK1151 ID	TkA03G507670
OH-1004 ID	LXL04_010149
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.700
Protein coverage (%)	TK1151 98.732 / OH-1004 98.387 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G507670

Location Chr03:127234226-127237942 (+)

Description Similar to SPHK1: Sphingosine kinase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21534`	Involved in the production of sphingolipid metabolites.	Phosphatidic acid binds and stimulates Arabidopsis sphingosine kinases.2011 · DOI: 10.1074/jbc.m110.190892 Connections between sphingosine kinase and phospholipase D in the abscisic acid signaling pathway in Arabidopsis.2012 · DOI: 10.1074/jbc.m111.274274
`At4g21540`	Involved in the production of sphingolipid metabolites.	Involvement of sphingosine kinase in plant cell signalling.2008 · DOI: 10.1111/j.1365-313x.2008.03579.x Phosphatidic acid binds and stimulates Arabidopsis sphingosine kinases.2011 · DOI: 10.1074/jbc.m110.190892 Connections between sphingosine kinase and phospholipase D in the abscisic acid signaling pathway in Arabidopsis.2012 · DOI: 10.1074/jbc.m111.274274
`At5g51290`	Catalyzes specifically the phosphorylation of ceramide to form ceramide 1-phosphate.	Ceramides modulate programmed cell death in plants.2003 · DOI: 10.1101/gad.1140503

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010149 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006473 protein acetylation Biological Process

GO:0006648 dihydrosphingosine-1-P pathway Biological Process

GO:0006665 sphingolipid metabolic process Biological Process

GO:0006670 sphingosine metabolic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009845 seed germination Biological Process

GO:0010803 regulation of tumor necrosis factor-mediated signaling pathway Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030100 regulation of endocytosis Biological Process

GO:0030148 sphingolipid biosynthetic process Biological Process

GO:0030307 positive regulation of cell growth Biological Process

GO:0030335 positive regulation of cell migration Biological Process

KEGG gene cross-reference

ath:AT4G21534

ath:AT4G21540

ddi:DDB_G0272522

hsa:8877

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.344

Rank 1 · TkA03G507670 · TK1151

Endoplasmic reticulum0.329

Rank 2 · TkA03G507670 · TK1151

Golgi apparatus0.193

Rank 3 · TkA03G507670 · TK1151

Cell membrane0.186

Rank 4 · TkA03G507670 · TK1151

Nucleus0.159

Rank 5 · TkA03G507670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11711Tim54109-152 aa

PF00781DAGK_cat113-246 aa

PF19280CERK_C272-429 aa

PF19279YegS_C364-442 aa

PF24348DUF7508434-461 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G507670	`PF11711`	Tim54	109	152	0.0095	15.5
TkA03G507670	`PF00781`	DAGK_cat	113	246	2.1e-28	99.2
TkA03G507670	`PF19280`	CERK_C	272	429	8.9e-08	32.6
TkA03G507670	`PF19279`	YegS_C	364	442	2.8e-12	47.3
TkA03G507670	`PF24348`	DUF7508	434	461	0.29	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F2Y4A3`	Arabidopsis thaliana	sp\|F2Y4A3\|SPHK2_ARATH Sphingosine kinase 2	59.800%	Swiss-Prot	High
`Q8L7L1`	Arabidopsis thaliana	sp\|Q8L7L1\|SPHK1_ARATH Sphingosine kinase 1	60.600%	Swiss-Prot	High
`Q6USK2`	Arabidopsis thaliana	sp\|Q6USK2\|CERK_ARATH Ceramide kinase	24.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card